View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_high_4 (Length: 631)

Name: NF0945_high_4
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0945_high_4
NF0945_high_4
[»] chr4 (1 HSPs)
chr4 (11-574)||(13970861-13971411)


Alignment Details
Target: chr4 (Bit Score: 275; Significance: 1e-153; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 275; E-Value: 1e-153
Query Start/End: Original strand, 11 - 574
Target Start/End: Complemental strand, 13971411 - 13970861
Alignment:
11 cataggcacgttgagttctcctttggcattcactaccattctccatgaataacgccctgtagaattcccattttgagaatcttccttgatatccccgtag 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||     
13971411 cataggcacgttgagttctcctttggcattcactaccattctccatgaataacgccctgtagaattcccgttttgagaatcttccttgatatccccataa 13971312  T
111 ttttccaaaacaaccgaaacaacctgagttaacaagagatgcaagctgtcaaatgaaagaagtatacgcgagggtaagacaagaggtaattttaagtgtt 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |   |||||||||||||  || | | ||| ||||    
13971311 ttttccaaaacaaccgaaacaacctgagttaacaagagatgcaagctgtcaaatgaaagaagtatgccgaagggtaagacaaggagtgactataactgtt 13971212  T
211 atacgatgttcgaaaacgattttagtcaatagtggtgtttatctcttacaatcagtatgtaatata-------atgaaagctatcgaaattaagttaatc 303  Q
    ||| |||||||| |   |||||||||||||||||||||||||||||||||||||||||||||||||       || |||||||||||||||||||| |||    
13971211 ataagatgttcgga---gattttagtcaatagtggtgtttatctcttacaatcagtatgtaatatattgaattatcaaagctatcgaaattaagttgatc 13971115  T
304 atgaagagnnnnnnnncaagatgaa-tttcaccactaaacacctaatgaaaggtcaaagaaagttcgccgtttcaagaagtaccaaaaaactataatcaa 402  Q
    ||||| |          ||||  || ||||  ||||||||||||| |   ||| |||||||||||||| | ||| |||||||||||||||||| ||||||    
13971114 atgaaaa------aaaaaagagaaattttctacactaaacacctagtttcaggacaaagaaagttcgctgattcgagaagtaccaaaaaactacaatcaa 13971021  T
403 gcactaatgtgttcttttctctgtgcgaaatgactaataccttaaaagaaaatgtaaacagatcagtaacttacattgtcaaattcaactgaaatatgag 502  Q
    |  |||||||||  ||||||| |||| |||             || |||||||||||| |||||| |||||||||||||||||||||||||||||||| |    
13971020 gtgctaatgtgtcattttctccgtgcaaaa------------caacagaaaatgtaaatagatcactaacttacattgtcaaattcaactgaaatatgcg 13970933  T
503 tgaattctcccatgaaccaaacctgtaaaacaagcaaagaatcttatcacttttacatcagcaataacagta 574  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
13970932 tgaattctcccatgaaccaaacctgtaaaacaagcaaagaatcttatcaattttacatcagcaataacagta 13970861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 125435 times since January 2019
Visitors: 1458