View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_high_47 (Length: 252)

Name: NF0945_high_47
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0945_high_47
[»] chr2 (2 HSPs)
chr2 (11-252)||(6953939-6954180)
chr2 (13-225)||(6963492-6963709)
[»] chr4 (3 HSPs)
chr4 (100-179)||(18134631-18134710)
chr4 (100-179)||(49121840-49121919)
chr4 (124-203)||(49105241-49105320)

Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr2

Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 11 - 252
Target Start/End: Original strand, 6953939 - 6954180
11 cacagataatgttttcaatgaggttttggatgctagcttttgtgttgatcatatcagaaatttttggagcttctttgaatatagttgaaggaaagcctca 110  Q
6953939 cacagataatgttttcaatgaggttttggatgctagcttttgtgttgatcatatcagaaatttttggagcttctttgaatatagttgaaggaaagcctca 6954038  T
111 aaggattcttttggatacagatgttgatactgatgatttatttgcacttctatatcttttgaagctcaatagatcagagtttctattagaggttagcaaa 210  Q
6954039 aaggattcttttggatacagatgttgatactgatgatttatttgcacttctatatcttttgaagctcaatagatcagagtttctattagaggttagcaaa 6954138  T
211 actaaccaaattgaaaaagtttccttaattcactttttcttt 252  Q
6954139 actaaccaaattgaaaaagtttccttaattcactttttcttt 6954180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 13 - 225
Target Start/End: Original strand, 6963492 - 6963709
13 cagataatgttttcaatgaggttttggatgctagcttttgtgttgatc-----atatcagaaatttttggagcttctttgaatatagttgaaggaaagcc 107  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||||||||||||||||||||    
6963492 cagagaatgttttcaatgaggttttggatgctagcttttgtgttgatcagatcatatcagaaatttttggagcttctttgaatatagttgaaggaaagcc 6963591  T
108 tcaaaggattcttttggatacagatgttgatactgatgatttatttgcacttctatatcttttgaagctcaatagatcagagtttctattagaggttagc 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| ||| |||| |||||||||||||    
6963592 tcaaaggattcttttggatacagatgttgatactgatgatttatttgcattgctatatcttttgaagctcaatagattagaatttcaattagaggttagc 6963691  T
208 aaaactaaccaaattgaa 225  Q
    ||||| ||||||||||||    
6963692 aaaacaaaccaaattgaa 6963709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 3)
Name: chr4

Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 100 - 179
Target Start/End: Complemental strand, 18134710 - 18134631
100 ggaaagcctcaaaggattcttttggatacagatgttgatactgatgatttatttgcacttctatatcttttgaagctcaa 179  Q
    |||||||||||| | ||| || ||||||| |||||||||||||||||||||||||| || || |||||| | ||||||||    
18134710 ggaaagcctcaacgaattgttgtggatactgatgttgatactgatgatttatttgctctgctttatcttcttaagctcaa 18134631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 100 - 179
Target Start/End: Complemental strand, 49121919 - 49121840
100 ggaaagcctcaaaggattcttttggatacagatgttgatactgatgatttatttgcacttctatatcttttgaagctcaa 179  Q
    |||||||||||| | ||| || ||||||| |||||||||||||||||||||||||| || || |||||| | ||||||||    
49121919 ggaaagcctcaacgaattgttgtggatactgatgttgatactgatgatttatttgctctgctttatcttcttaagctcaa 49121840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 203
Target Start/End: Complemental strand, 49105320 - 49105241
124 gatacagatgttgatactgatgatttatttgcacttctatatcttttgaagctcaatagatcagagtttctattagaggt 203  Q
    ||||||||||||| ||| || ||||||||||| || || || ||| | ||||||||||  |||||||||| |||||||||    
49105320 gatacagatgttgctaccgacgatttatttgctctactctaccttctcaagctcaatacttcagagtttcaattagaggt 49105241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 318676 times since January 2019
Visitors: 3039