View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_high_51 (Length: 251)

Name: NF0945_high_51
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0945_high_51
[»] chr6 (8 HSPs)
chr6 (1-245)||(11739727-11739971)
chr6 (1-227)||(12093973-12094199)
chr6 (1-227)||(11755736-11755962)
chr6 (1-136)||(11632001-11632136)
chr6 (5-145)||(11710537-11710677)
chr6 (1-136)||(11618096-11618231)
chr6 (4-135)||(11674023-11674154)
chr6 (1-145)||(11662912-11663056)
[»] chr1 (1 HSPs)
chr1 (7-144)||(44811503-44811640)
[»] scaffold0019 (1 HSPs)
scaffold0019 (43-136)||(8950-9043)
[»] scaffold0196 (1 HSPs)
scaffold0196 (44-134)||(12491-12581)

Alignment Details
Target: chr6 (Bit Score: 237; Significance: 1e-131; HSPs: 8)
Name: chr6

Target: chr6; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 11739971 - 11739727
1 ccactagcaaagttacaacataagtatctaagcaaacttctcgtggcacaagatgaaaggttaaaggctagttccgaggctctagtgaatgtgaaagtgt 100  Q
11739971 ccactagcaaagttacaacataagtatctaagcaaacttctcgtggcacaagatgaaaggttaaaggctagttccgaggctctagtgaatgtgaaagtgt 11739872  T
101 tgaagttatatgcatgggaaacccattttaaaaatgctatagaaagcctaagattttccgaactcaaattcttatcttcagtgctactgcaaaaagcata 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
11739871 tgaagttatatgcatgggaaacccattttaaaaatgctatagaaagcctcagattttccgaactcaaattcttatcttcagtgctactgcaaaaagcata 11739772  T
201 caatgtcattctcttctggttttcaccgttttttatctctgctgc 245  Q
    ||||||||||||||||||||||||||||||||| |||||||||||    
11739771 caatgtcattctcttctggttttcaccgtttttgatctctgctgc 11739727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 12094199 - 12093973
1 ccactagcaaagttacaacataagtatctaagcaaacttctcgtggcacaagatgaaaggttaaaggctagttccgaggctctagtgaatgtgaaagtgt 100  Q
    ||||||||||||||||||||||||||||| || |||||||| ||||| |||||||||||||| ||||||||||| |||||||| |||||| ||||||||     
12094199 ccactagcaaagttacaacataagtatcttagtaaacttctggtggcccaagatgaaaggttgaaggctagttctgaggctctggtgaatatgaaagtgc 12094100  T
101 tgaagttatatgcatgggaaacccattttaaaaatgctatagaaagcctaagattttccgaactcaaattcttatcttcagtgctactgcaaaaagcata 200  Q
    | |||||||||||||||||||  |||||||||||| | || |||| ||||||| ||   ||||  ||||| |||||||||||| || | ||||| |||||    
12094099 taaagttatatgcatgggaaatgcattttaaaaattccattgaaatcctaagaattgttgaacaaaaattgttatcttcagtgttattacaaaaggcata 12094000  T
201 caatgtcattctcttctggttttcacc 227  Q
    ||   | |||||||| |||||||||||    
12093999 cagccttattctcttttggttttcacc 12093973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 11755736 - 11755962
1 ccactagcaaagttacaacataagtatctaagcaaacttctcgtggcacaagatgaaaggttaaaggctagttccgaggctctagtgaatgtgaaagtgt 100  Q
    |||||||||||||||||||||||||||||||| |||||||| ||||| |||||||||||||| || |||||||| |||||||| |||||  ||||||||     
11755736 ccactagcaaagttacaacataagtatctaagtaaacttctggtggcccaagatgaaaggttgaaagctagttctgaggctctggtgaacatgaaagtgc 11755835  T
101 tgaagttatatgcatgggaaacccattttaaaaatgctatagaaagcctaagattttccgaactcaaattcttatcttcagtgctactgcaaaaagcata 200  Q
    | |||||||||||||||||||  |||||||||||| | || |||| ||||||| ||   |||   ||||| ||||||||||||||| | ||||| |||||    
11755836 taaagttatatgcatgggaaatgcattttaaaaattccattgaaatcctaagaattgttgaagaaaaattgttatcttcagtgctattacaaaaggcata 11755935  T
201 caatgtcattctcttctggttttcacc 227  Q
    ||   | || ||||| |||||||||||    
11755936 cagccttatgctcttttggttttcacc 11755962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 11632136 - 11632001
1 ccactagcaaagttacaacataagtatctaagcaaacttctcgtggcacaagatgaaaggttaaaggctagttccgaggctctagtgaatgtgaaagtgt 100  Q
    |||||||||||||||||||| |||||||  ||||||||| | |||||||||||||| || |||||||||||||| |||||||| |||||| |||||||||    
11632136 ccactagcaaagttacaacacaagtatcagagcaaacttatggtggcacaagatgagagattaaaggctagttcggaggctcttgtgaatatgaaagtgt 11632037  T
101 tgaagttatatgcatgggaaacccattttaaaaatg 136  Q
    ||||||| ||||| |||||||  |||||||||||||    
11632036 tgaagttgtatgcgtgggaaaatcattttaaaaatg 11632001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 5 - 145
Target Start/End: Complemental strand, 11710677 - 11710537
5 tagcaaagttacaacataagtatctaagcaaacttctcgtggcacaagatgaaaggttaaaggctagttccgaggctctagtgaatgtgaaagtgttgaa 104  Q
    |||||||||||||| | |||| ||  ||| ||||| | ||||||||||| || || || |||||||||||||||||||| |||||| |||||||| | ||    
11710677 tagcaaagttacaaaacaagtttcagagcgaacttatggtggcacaagacgagagattgaaggctagttccgaggctcttgtgaatatgaaagtgctcaa 11710578  T
105 gttatatgcatgggaaacccattttaaaaatgctatagaaa 145  Q
    ||||||||||||||||| |||||||||||||||||||||||    
11710577 gttatatgcatgggaaaaccattttaaaaatgctatagaaa 11710537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 11618096 - 11618231
1 ccactagcaaagttacaacataagtatctaagcaaacttctcgtggcacaagatgaaaggttaaaggctagttccgaggctctagtgaatgtgaaagtgt 100  Q
    ||||||||||| |||||||| |||| || || | ||||| | ||||| |||||||| || |||||||| ||||| |||||||| |||||| |||||||||    
11618096 ccactagcaaacttacaacacaagtttcaaacccaacttatggtggcgcaagatgagagattaaaggcgagttcggaggctcttgtgaatatgaaagtgt 11618195  T
101 tgaagttatatgcatgggaaacccattttaaaaatg 136  Q
    ||||| |||||||||||||||| |||||||||||||    
11618196 tgaagctatatgcatgggaaacacattttaaaaatg 11618231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 4 - 135
Target Start/End: Complemental strand, 11674154 - 11674023
4 ctagcaaagttacaacataagtatctaagcaaacttctcgtggcacaagatgaaaggttaaaggctagttccgaggctctagtgaatgtgaaagtgttga 103  Q
    ||||||||| ||||||| |||| ||  ||||||||  | ||||| |||||||| || ||||| || ||||| |||||||| |||||| ||||||||||||    
11674154 ctagcaaagctacaacacaagtttcagagcaaactaatggtggcgcaagatgagagattaaaagcgagttctgaggctcttgtgaatatgaaagtgttga 11674055  T
104 agttatatgcatgggaaacccattttaaaaat 135  Q
    || |||||||||||||||||||||||||||||    
11674054 agctatatgcatgggaaacccattttaaaaat 11674023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 145
Target Start/End: Original strand, 11662912 - 11663056
1 ccactagcaaagttacaacataagtatctaagcaaacttctcgtggcacaagatgaaaggttaaaggctagttccgaggctctagtgaatgtgaaagtgt 100  Q
    |||||||||||||| ||||| |||| ||  ||  ||||| | ||||||||||| || || || ||||||||||| |||||||| |||| | ||||||||     
11662912 ccactagcaaagttgcaacacaagtttcagagtgaacttatggtggcacaagacgagagattgaaggctagttctgaggctcttgtgagtatgaaagtgc 11663011  T
101 tgaagttatatgcatgggaaacccattttaaaaatgctatagaaa 145  Q
    | ||| |||||||||||||||| |||||||||| | |||||||||    
11663012 taaagctatatgcatgggaaacacattttaaaagttctatagaaa 11663056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 7 - 144
Target Start/End: Original strand, 44811503 - 44811640
7 gcaaagttacaacataagtatctaagcaaacttctcgtggcacaagatgaaaggttaaaggctagttccgaggctctagtgaatgtgaaagtgttgaagt 106  Q
    |||||||||||||| |||| || |||||||||| | || ||||||||||| || || ||||||| ||| |||||||| |||||| |||| ||| ||||||    
44811503 gcaaagttacaacacaagtttcaaagcaaacttatggtagcacaagatgagagattgaaggctacttctgaggctcttgtgaatatgaaggtgctgaagt 44811602  T
107 tatatgcatgggaaacccattttaaaaatgctatagaa 144  Q
    |||||||||||||||||   ||||||||| ||||||||    
44811603 tatatgcatgggaaaccagctttaaaaattctatagaa 44811640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0019 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: scaffold0019

Target: scaffold0019; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 43 - 136
Target Start/End: Complemental strand, 9043 - 8950
43 gtggcacaagatgaaaggttaaaggctagttccgaggctctagtgaatgtgaaagtgttgaagttatatgcatgggaaacccattttaaaaatg 136  Q
    |||||||||||||| || |||||||||||||  ||| || | || | | ||||||||||||||||||||||||||||||| |||||||||||||    
9043 gtggcacaagatgagagattaaaggctagttttgagtcttttgttactatgaaagtgttgaagttatatgcatgggaaacacattttaaaaatg 8950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0196 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0196

Target: scaffold0196; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 44 - 134
Target Start/End: Original strand, 12491 - 12581
44 tggcacaagatgaaaggttaaaggctagttccgaggctctagtgaatgtgaaagtgttgaagttatatgcatgggaaacccattttaaaaa 134  Q
    |||||||||| || || ||||||| |||||| || |||||   |||| |||||||||||||  ||||||||||||||| ||||||||||||    
12491 tggcacaagacgagagattaaaggttagttctgaagctctcacgaatatgaaagtgttgaaactatatgcatgggaaaaccattttaaaaa 12581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 109739 times since January 2019
Visitors: 1349