View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_high_57 (Length: 246)

Name: NF0945_high_57
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0945_high_57
[»] chr2 (1 HSPs)
chr2 (3-234)||(39298724-39298955)

Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 3 - 234
Target Start/End: Original strand, 39298724 - 39298955
3 tcacgccatgattcatctttcttcttagcagtaaactccttagcagtctcgccagcagaagcagccaaacctttcacaacatccaccgatttcgacgcaa 102  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||    
39298724 tcacgccatgattcatctttcttcttagcagtaaactccttagcagtctcaccagcagaagcagccaaacctttcacaacatccaccgatttcaacgcaa 39298823  T
103 gctcggccgcctttggtacaacatatccagccgctccttcaacagcatgcgctgcagccttagttccatccacggtcaacttcgtcgaataatgtgccgc 202  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39298824 gcccggccgcctttggtacaacatatccagccgctccttcaacagcatgcgctgcagccttagttccatccacggtcaacttcgtcgaataatgtgccgc 39298923  T
203 agtccaccctgccacggtggccttatccttca 234  Q
39298924 agtccaccctgccacggtggccttatccttca 39298955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 216749 times since January 2019
Visitors: 2908