View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_low_13 (Length: 496)

Name: NF0945_low_13
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0945_low_13
NF0945_low_13
[»] chr4 (1 HSPs)
chr4 (13-467)||(33398956-33399410)


Alignment Details
Target: chr4 (Bit Score: 358; Significance: 0; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 358; E-Value: 0
Query Start/End: Original strand, 13 - 467
Target Start/End: Original strand, 33398956 - 33399410
Alignment:
13 aatatcaattaagcattaatgttacttttcttatattatactcttaactcttactatcttctttctgnnnnnnnnnnnnaatatatatttctcatgacat 112  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||             ||| |||||||||||||||||    
33398956 aatatcaattaagcattaatgttacttttcttatattatacttttaactcttactatcttctttctattatttttttttaatttatatttctcatgacat 33399055  T
113 aaatgaaggata-ttttataagataattcataatttctannnnnnnacacagaattaattacattgcttactttgtaccaaaactaatcaatatggctta 211  Q
    |||||||||||| |||||||| |||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33399056 aaatgaaggatagttttataaaataattcataatttctatttttt-acacagaattaattacattgcttactttgtaccaaaactaatcaatatggctta 33399154  T
212 taatttaagagggagagagtataagttagttttgaaaagtggattttcattaaatttacccccacagcacaagatgtgcataaatggagggaaataacat 311  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
33399155 taatttaagagggagagagtataagttagttttgaaaagtggattttcattaaatttactcccacagcacaagatgtgcataaatggagggaaataacat 33399254  T
312 cagtccacatgctttacacggtacaaatgtaaccaaacaaaacaacatatacccaaggctacattcattgtgaggtacatctgtgtaactaataagaacc 411  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||    
33399255 cagtccacatgctttacacggtacaaatgtaaccaaacaaaacaacatatacccaaggctacattcattgtaaagtacatctgtgtaactaataagaacc 33399354  T
412 atctaatgcataattatgcagaagatggttttcaattctgcaccaacacttgcatc 467  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33399355 atctaatgcataattatgcagaagatggttttcaattctgcaccaacacttgcatc 33399410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 30763 times since January 2019
Visitors: 1588