View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_low_16 (Length: 450)

Name: NF0945_low_16
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0945_low_16
NF0945_low_16
[»] chr4 (2 HSPs)
chr4 (11-421)||(47900418-47900828)
chr4 (114-310)||(23554415-23554623)
[»] scaffold0727 (1 HSPs)
scaffold0727 (114-310)||(6536-6744)


Alignment Details
Target: chr4 (Bit Score: 378; Significance: 0; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 378; E-Value: 0
Query Start/End: Original strand, 11 - 421
Target Start/End: Complemental strand, 47900828 - 47900418
Alignment:
11 acaatattaaaacaaacgttgttcttgttaacttcttctctctaattcttcctcgtatttcgacaacacttccacaccaatcannnnnnncacctctctc 110  Q
    |||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||    
47900828 acaacattaaaacaaacgttgttcttgctaacttcttctctctaattcttcctcgtatttcgacaacacttccacaccaatcatttttttcacctctctc 47900729  T
111 tgccggagaaaccttgttccggtggtggcgggaacgaggtttgtttgaccgttaggtgtgtccacatggaggtttcatacgtgtcaccggaaagctctaa 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47900728 tgccggagaaaccttgttccggtggtggcgggaacgaggtttgtttgaccgttaggtgtgtccacatggaggtttcatacgtgtcaccggaaagctctaa 47900629  T
211 ggttgtgtcaccaagaacactaagaaagtctatagtggaaaaagtgtttggaaaatcgtattccattaaaggcagtggaagcttcaagaaacgtagtgag 310  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47900628 ggttgtgtcaccaagaacactaagaaagtctatagtggaaaaagtgtttggaaaatcgtattccattaaaggcagtggaagcttcaagaaacgtagtgag 47900529  T
311 tctcaaagttctatcaatgaagataatgaagttggcatggaactcatggaaattggagcagaaagaacaaaaaatgtgttgattctcatgagtgatactg 410  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47900528 tctcaaagttctatcaatgaagataatgaaggtggcatggaactcatggaaattggagcagaaagaacaaaaaatgtgttgattctcatgagtgatactg 47900429  T
411 gtggtggacat 421  Q
    |||||||||||    
47900428 gtggtggacat 47900418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 96; E-Value: 7e-47
Query Start/End: Original strand, 114 - 310
Target Start/End: Original strand, 23554415 - 23554623
Alignment:
114 cggagaaaccttgttccggtggtggcgggaacgaggtttgtttgaccgttaggtgtgtccac------------atggaggtttcatacgtgtcaccgga 201  Q
    |||||||| ||||||||| ||||||||| ||| ||||||||||||| |||||||||||||||            |||||||||||||| ||  |||  ||    
23554415 cggagaaatcttgttccgatggtggcggcaacaaggtttgtttgactgttaggtgtgtccactttttcggacacatggaggtttcatatgttacacgaga 23554514  T
202 aagctctaaggttgtgtcaccaagaacactaagaaagtctatagtggaaaaagtgtttggaaaatcgtattccattaaaggcagtggaagcttcaagaaa 301  Q
    ||||||||||||||| ||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||||||||||||     
23554515 aagctctaaggttgtatcaccaagaacaccaagtaagtctatagtggaaaaagtgtttggaaaatcgtatttcattagagggagtggaagcttcaagaag 23554614  T
302 cgtagtgag 310  Q
    | |||||||    
23554615 catagtgag 23554623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0727 (Bit Score: 96; Significance: 7e-47; HSPs: 1)
Name: scaffold0727
Description:

Target: scaffold0727; HSP #1
Raw Score: 96; E-Value: 7e-47
Query Start/End: Original strand, 114 - 310
Target Start/End: Original strand, 6536 - 6744
Alignment:
114 cggagaaaccttgttccggtggtggcgggaacgaggtttgtttgaccgttaggtgtgtccac------------atggaggtttcatacgtgtcaccgga 201  Q
    |||||||| ||||||||| ||||||||| ||| ||||||||||||| |||||||||||||||            |||||||||||||| ||  |||  ||    
6536 cggagaaatcttgttccgatggtggcggcaacaaggtttgtttgactgttaggtgtgtccactttttcggacacatggaggtttcatatgttacacgaga 6635  T
202 aagctctaaggttgtgtcaccaagaacactaagaaagtctatagtggaaaaagtgtttggaaaatcgtattccattaaaggcagtggaagcttcaagaaa 301  Q
    ||||||||||||||| ||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||||||||||||     
6636 aagctctaaggttgtatcaccaagaacaccaagtaagtctatagtggaaaaagtgtttggaaaatcgtatttcattagagggagtggaagcttcaagaag 6735  T
302 cgtagtgag 310  Q
    | |||||||    
6736 catagtgag 6744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 198894 times since January 2019
Visitors: 2774