View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_low_19 (Length: 407)

Name: NF0945_low_19
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0945_low_19
NF0945_low_19
[»] chr6 (5 HSPs)
chr6 (1-398)||(11755854-11756251)
chr6 (1-398)||(12093684-12094081)
chr6 (48-391)||(11739463-11739806)
chr6 (148-301)||(11618361-11618514)
chr6 (165-277)||(11631742-11631854)
[»] scaffold0196 (1 HSPs)
scaffold0196 (132-277)||(12697-12842)


Alignment Details
Target: chr6 (Bit Score: 374; Significance: 0; HSPs: 5)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 374; E-Value: 0
Query Start/End: Original strand, 1 - 398
Target Start/End: Original strand, 11755854 - 11756251
Alignment:
1 aaatgcattttaaaaattccattgaaatcctaagaattgttgaagaaaaattgttatcttcagtgctattacaaaaggcatacagccttatgctcttttg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11755854 aaatgcattttaaaaattccattgaaatcctaagaattgttgaagaaaaattgttatcttcagtgctattacaaaaggcatacagccttatgctcttttg 11755953  T
101 gttttcacctactttggtctctgcagctacctttttggcttgttacctcttgaaagttcctctccatgcaaataatgttttcacatttatcactactgtg 200  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||    
11755954 gttttcacctactttggtctctgctgctacctttttggcttgttacctcttgaaagttcctctccatgcaaataatgttttcacatttatcacaaccgtg 11756053  T
201 cgccttgtgcaagatcctatttcaaccattggagatgttattggagtgatcattcaagcaaaggttgctttttctcgggttgtgaaatttctcgaggcac 300  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11756054 cgccttgtgcaagatcctatttcaaccataggagatgttattggagtgatcattcaagcaaaggttgctttttctcgggttgtgaaatttctcgaggcac 11756153  T
301 ctgagcttcaaactactagtgttagaaagagctacaatgatgagaagttaaagggctcaattttaattaagtctgcagatttttcatgggagtataat 398  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
11756154 ctgagcttcaaactactagtgtcagaaagagctacaatgatgagaagttaaagggttcaattttaattaagtctgcagatttttcatgggagtataat 11756251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 1 - 398
Target Start/End: Complemental strand, 12094081 - 12093684
Alignment:
1 aaatgcattttaaaaattccattgaaatcctaagaattgttgaagaaaaattgttatcttcagtgctattacaaaaggcatacagccttatgctcttttg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| ||||||||    
12094081 aaatgcattttaaaaattccattgaaatcctaagaattgttgaacaaaaattgttatcttcagtgttattacaaaaggcatacagccttattctcttttg 12093982  T
101 gttttcacctactttggtctctgcagctacctttttggcttgttacctcttgaaagttcctctccatgcaaataatgttttcacatttatcactactgtg 200  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||    
12093981 gttttcacctactttggtctctgctgctacctttttggcttgttacctcttgaaagttcctctccatgcaaataatgttttcacatttatcacaaccgtg 12093882  T
201 cgccttgtgcaagatcctatttcaaccattggagatgttattggagtgatcattcaagcaaaggttgctttttctcgggttgtgaaatttctcgaggcac 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12093881 cgccttgtgcaagatcctatttcaaccattggagatgttattggagtgatcattcaagcaaaggttgctttttctcgggttgtgaaatttctcgaggcac 12093782  T
301 ctgagcttcaaactactagtgttagaaagagctacaatgatgagaagttaaagggctcaattttaattaagtctgcagatttttcatgggagtataat 398  Q
    |||||||||||||||||||||| |||||||||| | | |||||||||||||||||||||||   ||| ||||||||||||||||||||||| ||||||    
12093781 ctgagcttcaaactactagtgtcagaaagagctgctacgatgagaagttaaagggctcaataaaaatcaagtctgcagatttttcatgggaatataat 12093684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 48 - 391
Target Start/End: Complemental strand, 11739806 - 11739463
Alignment:
48 aaattgttatcttcagtgctattacaaaaggcatacagccttatgctcttttggttttcacctactttggtctctgcagctacctttttggcttgttacc 147  Q
    ||||| ||||||||||||||| | ||||| |||||||   | || ||||| |||||||||||   |||| ||||||| || || |||   || ||||||     
11739806 aaattcttatcttcagtgctactgcaaaaagcatacaatgtcattctcttctggttttcaccgtttttgatctctgctgcgacatttagtgcatgttact 11739707  T
148 tcttgaaagttcctctccatgcaaataatgttttcacatttatcactactgtgcgccttgtgcaagatcctatttcaaccattggagatgttattggagt 247  Q
    ||||||| |||||| | ||||| |||||| | ||||| ||| |  | ||  | || ||| |||||||||| |||||||||||    ||||||||||||||    
11739706 tcttgaatgttcctttacatgcgaataatatattcacctttgtggcaacaatacgacttatgcaagatccaatttcaaccatccctgatgttattggagt 11739607  T
248 gatcattcaagcaaaggttgctttttctcgggttgtgaaatttctcgaggcacctgagcttcaaactactagtgttagaaagagctacaatgatgagaag 347  Q
    |||||||||||||||  |||| ||||||||| ||||| |||| ||||||||||||||| | || | | | | | | |||||||  | |  |||||| |||    
11739606 gatcattcaagcaaatattgcattttctcggattgtggaattcctcgaggcacctgagttgcagagttcaaatttcagaaagacttgctttgatgaaaag 11739507  T
348 ttaaagggctcaattttaattaagtctgcagatttttcatggga 391  Q
    || || |||||||||||||| |||||| | || |||||||||||    
11739506 ttgaatggctcaattttaatcaagtcttctgacttttcatggga 11739463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 148 - 301
Target Start/End: Original strand, 11618361 - 11618514
Alignment:
148 tcttgaaagttcctctccatgcaaataatgttttcacatttatcactactgtgcgccttgtgcaagatcctatttcaaccattggagatgttattggagt 247  Q
    |||||||  |||||||  |||||| |||||||||||||||  || | ||| |||||||||| |||||||| ||| ||| |||   ||| ||||||| ||     
11618361 tcttgaagattcctctgaatgcaagtaatgttttcacattggtcgcaactttgcgccttgttcaagatccaattgcaaacatcccagaagttattgcagc 11618460  T
248 gatcattcaagcaaaggttgctttttctcgggttgtgaaatttctcgaggcacc 301  Q
    ||||||||| || || ||||| ||| ||||| |||| || || || ||||||||    
11618461 gatcattcaggcgaaagttgcatttgctcggattgttaatttccttgaggcacc 11618514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 165 - 277
Target Start/End: Complemental strand, 11631854 - 11631742
Alignment:
165 catgcaaataatgttttcacatttatcactactgtgcgccttgtgcaagatcctatttcaaccattggagatgttattggagtgatcattcaagcaaagg 264  Q
    ||||||| |||||||||||| ||| |  | |||||||||||||| ||||| || ||| |||  |||  |||||| ||||  ||||||||||| ||||| |    
11631854 catgcaagtaatgttttcacttttgtggcaactgtgcgccttgttcaagagccaattacaagtattccagatgtcattgcggtgatcattcaggcaaaag 11631755  T
265 ttgctttttctcg 277  Q
    |||| ||| ||||    
11631754 ttgcatttgctcg 11631742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0196 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0196
Description:

Target: scaffold0196; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 132 - 277
Target Start/End: Original strand, 12697 - 12842
Alignment:
132 tttttggcttgttacctcttgaaagttcctctccatgcaaataatgttttcacatttatcactactgtgcgccttgtgcaagatcctatttcaaccattg 231  Q
    |||||||| |||||| ||||| |||||||  | ||||||| |||||||||||||||| |  | ||| ||  |||||| |||||||| ||||||| ||||     
12697 tttttggcatgttacttcttggaagttccattgcatgcaagtaatgttttcacatttgtggcaactttgaaccttgttcaagatccaatttcaagcattc 12796  T
232 gagatgttattggagtgatcattcaagcaaaggttgctttttctcg 277  Q
      |||||||||  || ||| |||||||| || ||||| ||| ||||    
12797 cggatgttattacagcgattattcaagctaaagttgcatttgctcg 12842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 176141 times since January 2019
Visitors: 2680