View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_low_2 (Length: 777)

Name: NF0945_low_2
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0945_low_2
NF0945_low_2
[»] chr7 (2 HSPs)
chr7 (7-713)||(28438553-28439260)
chr7 (640-673)||(35616367-35616400)
[»] chr2 (1 HSPs)
chr2 (536-579)||(696996-697039)


Alignment Details
Target: chr7 (Bit Score: 653; Significance: 0; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 653; E-Value: 0
Query Start/End: Original strand, 7 - 713
Target Start/End: Complemental strand, 28439260 - 28438553
Alignment:
7 tccaacaatatttcacacacacaacgttagacattaaatttcaagatatcgattgactggacaagttcatgttctgttatgtagacaattagattggagt 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28439260 tccaacaatatttcacacacacaacgttagacattaaatttcaagatatcgattgactggacaagttcatgttctgttatgtagacaattagattggagt 28439161  T
107 attatcattcctgcaaatggtacatgggctatatacttcgttaatatattttcttggcgttagctctccggtttttaggaaaagacacacaatcaaagat 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28439160 attatcattcctgcaaatggtacatgggctatatacttcgttaatatattttcttggcgttagctctccggtttttaggaaaagacacacaatcaaagat 28439061  T
207 aagaacggtctaatcaataatgttccatttacaaatcaaactcgtgtttttcgtatcgatttatattttggtggatgttataacacttgatcctcttatt 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| || ||||||    
28439060 aagaacggtctaatcaataatgttccatttacaaatcaaactcgtgtttttcgtaacgattcatattttggtggatgttataacacttgagccacttatt 28438961  T
307 ttttgttttgttgtgaagacaacacctgagccacttggttaatattctatttgggcgtgtaatacaatttaaactatttatcgggtttctctcaatatac 406  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28438960 ttttgttttgttttgaagacaacacctgagccacttggttaatattctatttgggcgtgtaatacaatttaaactatttatcgggtttctctcaatatac 28438861  T
407 gtataaacactaaaaattgttaattggtaaatattgctgtactcctccataaaaaattgaaaggctatctgaaatattgtcgggtttcactgcttttaga 506  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28438860 gtataaacactaaaaattgttaattggtaaatattgctgtactcctccataaaaaattgaaaggctatctgaaatattgtcgggtttcactgcttttaga 28438761  T
507 taaccttcattcagtaggttgacacctttttagggaatccactcctttgcttggtaaacaagcaacaatatatatattgctttactcgcatggaatggag 606  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28438760 taaccttcattcagtaggttgacacctttttagggaatccactcctttgcttggtaaacaagcaacaatatatatattgctttactcgcatggaatggag 28438661  T
607 ttggaaaataataaataataacttgaattttagtagaagattaagcttgaaacctgtgaggatctcat-nnnnnnnnnccaagtttgcataaagccacac 705  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||||    
28438660 ttggaaaataataaataataacttgaattttagtagaagattaagcttgaaacctgtgaggatctcataaaaaaaaaaccaagtttgcataaagccacac 28438561  T
706 gttcttct 713  Q
    ||||||||    
28438560 gttcttct 28438553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 640 - 673
Target Start/End: Original strand, 35616367 - 35616400
Alignment:
640 tagaagattaagcttgaaacctgtgaggatctca 673  Q
    |||||||||||||||||| |||||||||||||||    
35616367 tagaagattaagcttgaagcctgtgaggatctca 35616400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 36; Significance: 0.00000000007; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 536 - 579
Target Start/End: Original strand, 696996 - 697039
Alignment:
536 ttagggaatccactcctttgcttggtaaacaagcaacaatatat 579  Q
    ||||||||||||||| ||||||||||||| ||||||||||||||    
696996 ttagggaatccactcatttgcttggtaaataagcaacaatatat 697039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175504 times since January 2019
Visitors: 2677