View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_low_21 (Length: 389)

Name: NF0945_low_21
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0945_low_21
[»] chr4 (2 HSPs)
chr4 (13-385)||(31099750-31100122)
chr4 (64-141)||(21546655-21546735)

Alignment Details
Target: chr4 (Bit Score: 341; Significance: 0; HSPs: 2)
Name: chr4

Target: chr4; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 13 - 385
Target Start/End: Complemental strand, 31100122 - 31099750
13 aatatgatctctctattattgtttcatcgattaaactgaacaaactgaaatatatgtttaaataaacactttccgtactcaaaacatggttaattgttga 112  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||  ||||||| ||||    
31100122 aatatgatctctctattattgttttatcgattaaactgaacaaactgaaatatatgtttaaataaacactttccttactcagaacagtgttaattattga 31100023  T
113 acaacttttgtatcgcacgagtccttgtggatatgatactttgagtacttattttttatgctgctataaaagcaactcaccagtcatcgagaaaaccata 212  Q
31100022 acaacttttgtatcgcacgagtccttgtggatatgatactttgagtacttattttttatgctgctataaaagcaactcaccagtcatcgagaaaaccata 31099923  T
213 gtcatataaaacaagacatttgttgttgagaatgaacaaagaagagtcggatctgaagttcacaaacccatagtcatagagaaatttacacaaggttttg 312  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
31099922 gtcatataaaacaagacatttgttgttgagaatgaacaaagaagagtcggatttgaagttcacaaacccatagtcatagagaaatttacacaaggttttg 31099823  T
313 aaccaggaaagtggtgtgttgggtttaggccgtaaataaactttcgtaggtgacaaatgttgtcatctgtttg 385  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31099822 aaccaggcaagtggtgtgttgggtttaggccgtaaataaactttcgtaggtgacaaatgttgtcatctgtttg 31099750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 141
Target Start/End: Original strand, 21546655 - 21546735
64 atatgtttaaataaacac--tttccgtactcaaaacatggttaa-ttgttgaacaacttttgtatcgcacgagtccttgtg 141  Q
    |||||||||||||||| |  |||||||||||||||||   |||| || || ||||||||| ||||||||||||||| ||||    
21546655 atatgtttaaataaactcattttccgtactcaaaacagttttaaatttttaaacaactttggtatcgcacgagtccatgtg 21546735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 125026 times since January 2019
Visitors: 1417