View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_low_21 (Length: 389)

Name: NF0945_low_21
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0945_low_21
NF0945_low_21
[»] chr4 (2 HSPs)
chr4 (13-385)||(31099750-31100122)
chr4 (64-141)||(21546655-21546735)


Alignment Details
Target: chr4 (Bit Score: 341; Significance: 0; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 13 - 385
Target Start/End: Complemental strand, 31100122 - 31099750
Alignment:
13 aatatgatctctctattattgtttcatcgattaaactgaacaaactgaaatatatgtttaaataaacactttccgtactcaaaacatggttaattgttga 112  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||  ||||||| ||||    
31100122 aatatgatctctctattattgttttatcgattaaactgaacaaactgaaatatatgtttaaataaacactttccttactcagaacagtgttaattattga 31100023  T
113 acaacttttgtatcgcacgagtccttgtggatatgatactttgagtacttattttttatgctgctataaaagcaactcaccagtcatcgagaaaaccata 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31100022 acaacttttgtatcgcacgagtccttgtggatatgatactttgagtacttattttttatgctgctataaaagcaactcaccagtcatcgagaaaaccata 31099923  T
213 gtcatataaaacaagacatttgttgttgagaatgaacaaagaagagtcggatctgaagttcacaaacccatagtcatagagaaatttacacaaggttttg 312  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
31099922 gtcatataaaacaagacatttgttgttgagaatgaacaaagaagagtcggatttgaagttcacaaacccatagtcatagagaaatttacacaaggttttg 31099823  T
313 aaccaggaaagtggtgtgttgggtttaggccgtaaataaactttcgtaggtgacaaatgttgtcatctgtttg 385  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31099822 aaccaggcaagtggtgtgttgggtttaggccgtaaataaactttcgtaggtgacaaatgttgtcatctgtttg 31099750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 141
Target Start/End: Original strand, 21546655 - 21546735
Alignment:
64 atatgtttaaataaacac--tttccgtactcaaaacatggttaa-ttgttgaacaacttttgtatcgcacgagtccttgtg 141  Q
    |||||||||||||||| |  |||||||||||||||||   |||| || || ||||||||| ||||||||||||||| ||||    
21546655 atatgtttaaataaactcattttccgtactcaaaacagttttaaatttttaaacaactttggtatcgcacgagtccatgtg 21546735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 295146 times since January 2019
Visitors: 3016