View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_low_34 (Length: 335)

Name: NF0945_low_34
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0945_low_34
NF0945_low_34
[»] chr4 (19 HSPs)
chr4 (1-316)||(7723579-7723894)
chr4 (87-173)||(6659332-6659419)
chr4 (87-173)||(19935487-19935574)
chr4 (98-174)||(13991391-13991469)
chr4 (87-169)||(40206153-40206236)
chr4 (87-175)||(24667655-24667744)
chr4 (98-174)||(17254895-17254973)
chr4 (103-174)||(54700614-54700687)
chr4 (96-170)||(18657052-18657128)
chr4 (123-173)||(38888028-38888079)
chr4 (98-167)||(50515907-50515978)
chr4 (87-174)||(7634079-7634167)
chr4 (131-176)||(21433610-21433655)
chr4 (91-175)||(7724082-7724165)
chr4 (123-173)||(18689559-18689610)
chr4 (136-174)||(13990729-13990767)
chr4 (102-170)||(22486792-22486861)
chr4 (136-173)||(9260573-9260610)
chr4 (123-175)||(10494901-10494954)
[»] chr2 (25 HSPs)
chr2 (87-173)||(36647293-36647380)
chr2 (87-176)||(15129387-15129477)
chr2 (87-173)||(27952319-27952407)
chr2 (96-175)||(23457644-23457725)
chr2 (87-173)||(22011436-22011524)
chr2 (87-173)||(33655628-33655715)
chr2 (87-170)||(2155970-2156055)
chr2 (87-174)||(33051617-33051706)
chr2 (87-173)||(27956155-27956243)
chr2 (87-173)||(31636337-31636425)
chr2 (98-174)||(5171597-5171675)
chr2 (98-175)||(12966475-12966553)
chr2 (98-175)||(21772373-21772451)
chr2 (170-239)||(27955588-27955657)
chr2 (87-170)||(31634107-31634192)
chr2 (98-168)||(28737911-28737982)
chr2 (87-175)||(1518191-1518280)
chr2 (98-173)||(4184929-4185006)
chr2 (123-174)||(32162007-32162059)
chr2 (98-169)||(8294582-8294655)
chr2 (102-169)||(28737841-28737910)
chr2 (87-173)||(32163773-32163860)
chr2 (127-168)||(23456580-23456622)
chr2 (123-168)||(2165899-2165944)
chr2 (138-174)||(12123950-12123986)
[»] chr8 (27 HSPs)
chr8 (87-173)||(2189723-2189810)
chr8 (97-171)||(42890394-42890469)
chr8 (87-173)||(42891665-42891753)
chr8 (87-170)||(24731035-24731120)
chr8 (87-173)||(22921851-22921939)
chr8 (87-169)||(24731231-24731315)
chr8 (87-175)||(18468647-18468736)
chr8 (87-173)||(6845336-6845424)
chr8 (87-173)||(22512047-22512135)
chr8 (87-173)||(22519347-22519435)
chr8 (87-173)||(22926649-22926737)
chr8 (87-173)||(37189866-37189954)
chr8 (170-241)||(42890977-42891048)
chr8 (109-173)||(23570584-23570649)
chr8 (131-174)||(2687741-2687784)
chr8 (170-241)||(23571081-23571151)
chr8 (99-173)||(26374900-26374975)
chr8 (170-241)||(42891109-42891180)
chr8 (123-173)||(23573583-23573633)
chr8 (109-176)||(16598246-16598315)
chr8 (109-173)||(22520823-22520888)
chr8 (87-143)||(26378031-26378088)
chr8 (125-175)||(2689144-2689195)
chr8 (98-175)||(14130163-14130242)
chr8 (98-175)||(20693797-20693876)
chr8 (136-173)||(2609547-2609584)
chr8 (87-123)||(18180714-18180750)
[»] chr1 (22 HSPs)
chr1 (87-175)||(31915548-31915637)
chr1 (87-173)||(8931220-8931308)
chr1 (99-174)||(12944115-12944192)
chr1 (87-173)||(50857445-50857533)
chr1 (112-170)||(13444015-13444074)
chr1 (98-175)||(28660758-28660837)
chr1 (97-175)||(31913375-31913454)
chr1 (176-241)||(13443411-13443476)
chr1 (98-173)||(9031017-9031094)
chr1 (87-166)||(40058103-40058184)
chr1 (102-173)||(50713713-50713786)
chr1 (131-166)||(10927199-10927234)
chr1 (102-169)||(43681465-43681535)
chr1 (98-174)||(10925739-10925814)
chr1 (98-173)||(10928289-10928366)
chr1 (98-173)||(28661080-28661157)
chr1 (123-175)||(33152757-33152810)
chr1 (98-168)||(23987581-23987653)
chr1 (98-175)||(239685-239764)
chr1 (101-174)||(8221487-8221562)
chr1 (130-176)||(8967850-8967896)
chr1 (123-168)||(26981516-26981561)
[»] chr7 (29 HSPs)
chr7 (87-173)||(13882687-13882775)
chr7 (87-170)||(5934607-5934691)
chr7 (87-170)||(13886160-13886245)
chr7 (90-174)||(30217814-30217898)
chr7 (87-173)||(859157-859245)
chr7 (87-173)||(1217161-1217249)
chr7 (98-175)||(3778721-3778799)
chr7 (87-175)||(4888687-4888776)
chr7 (99-176)||(1883486-1883565)
chr7 (109-174)||(27309638-27309705)
chr7 (98-174)||(11000838-11000916)
chr7 (104-176)||(1365669-1365742)
chr7 (123-175)||(24840141-24840194)
chr7 (123-175)||(27142664-27142717)
chr7 (98-175)||(1369803-1369882)
chr7 (87-174)||(1874537-1874626)
chr7 (92-173)||(1220446-1220529)
chr7 (127-176)||(1753640-1753690)
chr7 (123-166)||(8063842-8063885)
chr7 (98-174)||(4133286-4133364)
chr7 (87-175)||(7803032-7803122)
chr7 (123-176)||(11228978-11229032)
chr7 (131-176)||(1786680-1786725)
chr7 (98-173)||(6451762-6451839)
chr7 (94-175)||(13466729-13466812)
chr7 (108-174)||(35814870-35814937)
chr7 (136-174)||(11228720-11228758)
chr7 (87-174)||(8916379-8916467)
chr7 (141-170)||(13886245-13886274)
[»] chr6 (21 HSPs)
chr6 (87-173)||(3536034-3536122)
chr6 (87-173)||(3542245-3542333)
chr6 (101-169)||(11658936-11659005)
chr6 (94-168)||(8048974-8049049)
chr6 (87-175)||(27822119-27822209)
chr6 (104-175)||(14238434-14238507)
chr6 (90-173)||(29340810-29340895)
chr6 (87-169)||(30049920-30050004)
chr6 (87-173)||(33615505-33615593)
chr6 (123-169)||(30052207-30052253)
chr6 (98-166)||(18727115-18727184)
chr6 (98-173)||(12882123-12882200)
chr6 (87-166)||(18718201-18718279)
chr6 (90-165)||(22889268-22889345)
chr6 (90-165)||(22910810-22910887)
chr6 (106-169)||(1127258-1127323)
chr6 (88-120)||(8047390-8047422)
chr6 (185-241)||(8048395-8048451)
chr6 (90-165)||(22873822-22873897)
chr6 (131-176)||(24443118-24443163)
chr6 (123-167)||(33215201-33215246)
[»] chr3 (11 HSPs)
chr3 (87-173)||(5128909-5128997)
chr3 (87-173)||(43303961-43304049)
chr3 (87-173)||(43306673-43306761)
chr3 (87-175)||(2472690-2472779)
chr3 (170-241)||(43306216-43306287)
chr3 (87-173)||(3063738-3063826)
chr3 (87-173)||(3068876-3068964)
chr3 (87-174)||(365594-365682)
chr3 (98-176)||(33175832-33175912)
chr3 (98-176)||(52708841-52708921)
chr3 (123-166)||(45168358-45168401)
[»] chr5 (8 HSPs)
chr5 (86-173)||(21848965-21849054)
chr5 (131-175)||(19497351-19497395)
chr5 (87-173)||(40778787-40778875)
chr5 (104-173)||(492567-492638)
chr5 (98-176)||(22440855-22440934)
chr5 (134-174)||(18252415-18252455)
chr5 (98-174)||(26140342-26140420)
chr5 (127-175)||(9868447-9868496)
[»] scaffold0054 (3 HSPs)
scaffold0054 (99-170)||(37714-37786)
scaffold0054 (123-176)||(49319-49372)
scaffold0054 (90-165)||(10663-10740)
[»] scaffold0531 (1 HSPs)
scaffold0531 (94-168)||(11597-11672)
[»] scaffold0251 (1 HSPs)
scaffold0251 (87-175)||(9700-9791)
[»] scaffold0110 (2 HSPs)
scaffold0110 (87-157)||(46734-46806)
scaffold0110 (132-173)||(45310-45351)
[»] scaffold0240 (3 HSPs)
scaffold0240 (97-170)||(14850-14924)
scaffold0240 (107-174)||(1657-1725)
scaffold0240 (102-169)||(16051-16119)
[»] scaffold0024 (1 HSPs)
scaffold0024 (98-174)||(145733-145811)
[»] scaffold0236 (1 HSPs)
scaffold0236 (99-175)||(16396-16473)
[»] scaffold0330 (1 HSPs)
scaffold0330 (107-174)||(17639-17707)


Alignment Details
Target: chr4 (Bit Score: 280; Significance: 1e-157; HSPs: 19)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 316
Target Start/End: Original strand, 7723579 - 7723894
Alignment:
1 tgtcgagcaaccaatcattccaaacctcttaccacaaactattgaatcaccatctccctcgggggaaggttgttacgatccttaacgacgcagtacagaa 100  Q
    |||| ||||||||| |||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
7723579 tgtcaagcaaccaagcattccaaacctcttaccacaaactatttaatcaccttctccctcgggggaaggttgttacgatccttaacgacgcagtacagaa 7723678  T
101 gcgtaggctagcaagcactaaactagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttccacagacgttggaaacgcttcagtcg 200  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| ||||    
7723679 gcgtaggctagcaagcgctaaactagattgaaaagaacaagtttgcaagctacaaacttgtgaaaatagggttccacagacgtcggaaacgcttcggtcg 7723778  T
201 tctgagcaacgtcgatctcctcttgcaacggcgtaagaattttgtcacactccaccacgtggaactctaattgatccacatctcatgttttgattgtttc 300  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7723779 tctgagcaacgtcgatctcctcttgcaacggcataagaattttgtcacactccaccacgtggaactctaattgatccacatctcatgttttgattgtttc 7723878  T
301 tattgatgatgatgtc 316  Q
    ||||||||||||||||    
7723879 tattgatgatgatgtc 7723894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 87 - 173
Target Start/End: Original strand, 6659332 - 6659419
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaa-ctagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||| |||| ||||| |||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||    
6659332 gacgcagtacggaagtgtaggttagcaagcgctaaatctagatagaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 6659419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 87 - 173
Target Start/End: Complemental strand, 19935574 - 19935487
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaact-agattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||||||||||||||||||| ||| ||||||| |||| ||||| || || |||||||||||||||||| |||||||||||||    
19935574 gacgcagtacagaagcgtaggctagccagcgctaaactcagatagaaaaaaataaatttgcaagcgacaaacttatgaaaatagggtt 19935487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 98 - 174
Target Start/End: Original strand, 13991391 - 13991469
Alignment:
98 gaagcgtaggctagcaagcactaaa-ctagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    ||||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||| || ||||||| |||||    
13991391 gaagcgtaggctagcaagcgctaaatctagattgaaaagaaacaagtttgcaagcgacaaacatgcgaaaataaggttc 13991469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 87 - 169
Target Start/End: Complemental strand, 40206236 - 40206153
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaa-ctagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatag 169  Q
    |||||| ||| ||||||||||||||||||| ||||| ||| |||||||   ||||||| |||||||||||||||||||||||||    
40206236 gacgcactacggaagcgtaggctagcaagcgctaaatctaaattgaaagagacaagttcgcaagcgacaaacttgtgaaaatag 40206153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 87 - 175
Target Start/End: Complemental strand, 24667744 - 24667655
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    |||||||||  |||||||||||||||||||  ||||| ||||| |||||||| ||| | ||| || ||||||||||||||||||||||||    
24667744 gacgcagtatggaagcgtaggctagcaagcgttaaacctagatagaaaagaagaagctcgcaggcaacaaacttgtgaaaatagggttcc 24667655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 98 - 174
Target Start/End: Original strand, 17254895 - 17254973
Alignment:
98 gaagcgtaggctagcaagcactaaact-agattgaaaa-gaacaagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    ||||||||||||||||| | ||||||| |||||||| | |||||| ||| |||||||||||||||||||||||| ||||    
17254895 gaagcgtaggctagcaaacgctaaacttagattgaagatgaacaaattttcaagcgacaaacttgtgaaaatagagttc 17254973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 103 - 174
Target Start/End: Original strand, 54700614 - 54700687
Alignment:
103 gtaggctagcaagcactaaac-tagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    |||||||||||| | |||||| || ||||||||||| |||||||||||| ||||||||||||| ||||||||||    
54700614 gtaggctagcaaacgctaaacctatattgaaaagaaacaagtttgcaagtgacaaacttgtgagaatagggttc 54700687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 96 - 170
Target Start/End: Original strand, 18657052 - 18657128
Alignment:
96 cagaagcgtaggctagcaagcactaaac-tagattgaaaagaacaa-gtttgcaagcgacaaacttgtgaaaatagg 170  Q
    |||||||||| |||||  |||||||||| |||||||||||||| || ||||||| ||||||||||||| ||||||||    
18657052 cagaagcgtaagctagagagcactaaacctagattgaaaagaaaaaagtttgcatgcgacaaacttgtaaaaatagg 18657128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 173
Target Start/End: Original strand, 38888028 - 38888079
Alignment:
123 ctagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||||| || ||| ||||||||||||||||||||||||||||||||    
38888028 ctagattgaaaataaacaaatttgcaagcgacaaacttgtgaaaatagggtt 38888079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 98 - 167
Target Start/End: Original strand, 50515907 - 50515978
Alignment:
98 gaagcgtaggctagcaagcactaaact-agattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaat 167  Q
    |||||| |||||||||||| ||| ||| ||| ||| ||||| ||||||||||||||||||||||||||||||    
50515907 gaagcggaggctagcaagcgctacacttagactgagaagaaacaagtttgcaagcgacaaacttgtgaaaat 50515978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 87 - 174
Target Start/End: Complemental strand, 7634167 - 7634079
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaac-tagattgaaaag-aacaagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    |||||||| |||||||||| ||||| ||||  ||||| |||||||||||| ||||||||||||| ||| ||||||||| |||||| ||||    
7634167 gacgcagt-cagaagcgtatgctagtaagcgttaaacctagattgaaaaggaacaagtttgcaaacgataaacttgtggaaatagagttc 7634079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 131 - 176
Target Start/End: Original strand, 21433610 - 21433655
Alignment:
131 aaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttcca 176  Q
    |||||||||| || ||||||||||||||| ||||||||||||||||    
21433610 aaaagaacaaattcgcaagcgacaaacttatgaaaatagggttcca 21433655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 91 - 175
Target Start/End: Original strand, 7724082 - 7724165
Alignment:
91 cagtacagaagcgtaggctagcaagcactaaac-tagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    |||||||||| |||| |||||||||  |||||| || ||||||||||| ||||||||| ||||||||||   |||||||||||||||    
7724082 cagtacagaaacgtatgctagcaagtgctaaacctatattgaaaagaagcaagtttgcgagcgacaaac---tgaaaatagggttcc 7724165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 123 - 173
Target Start/End: Original strand, 18689559 - 18689610
Alignment:
123 ctagattgaaaagaacaa-gtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    ||||||||||||||| || ||||||| ||||||||||||| |||||||||||    
18689559 ctagattgaaaagaaaaaagtttgcatgcgacaaacttgtaaaaatagggtt 18689610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 136 - 174
Target Start/End: Original strand, 13990729 - 13990767
Alignment:
136 aacaagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    ||||||||||||||  |||||||||||||||||||||||    
13990729 aacaagtttgcaagtaacaaacttgtgaaaatagggttc 13990767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 22486792 - 22486861
Alignment:
102 cgtaggctagcaagcactaaac-tagattgaaaa-gaacaagtttgcaagcgacaaacttgtgaaaatagg 170  Q
    ||||||||||||||| |||||| || || ||||| || |||||||||||||||| ||||||||||||||||    
22486792 cgtaggctagcaagcgctaaacctatatagaaaaagaccaagtttgcaagcgac-aacttgtgaaaatagg 22486861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 136 - 173
Target Start/End: Complemental strand, 9260610 - 9260573
Alignment:
136 aacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    ||||||||||||| ||||||||||| ||||||||||||    
9260610 aacaagtttgcaaacgacaaacttgcgaaaatagggtt 9260573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 123 - 175
Target Start/End: Complemental strand, 10494954 - 10494901
Alignment:
123 ctagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    |||||| |||||||| |||||||||||| ||||||| ||||||||||| |||||    
10494954 ctagatggaaaagaaacaagtttgcaagtgacaaacctgtgaaaatagagttcc 10494901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 68; Significance: 2e-30; HSPs: 25)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 87 - 173
Target Start/End: Complemental strand, 36647380 - 36647293
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||| ||||||||||||||||||| |||||| | ||||||||||||||||||||||||||||||||||||||||||||||||    
36647380 gacgcagtacggaagcgtaggctagcaagcgctaaacctcgattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 36647293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 87 - 176
Target Start/End: Complemental strand, 15129477 - 15129387
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttcca 176  Q
    |||| ||||| ||||||||||||||||||| |||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||||||    
15129477 gacgtagtacggaagcgtaggctagcaagcgctaaacctagatagaaaagaacaagttcgcaagcgacaaacttgtgaaaatagggttcca 15129387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 87 - 173
Target Start/End: Original strand, 27952319 - 27952407
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||| |||||||||| | ||||||| |||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||    
27952319 gacgcagtacggaagcgtagggttagcaagcgctaaacctagatagaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 27952407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 96 - 175
Target Start/End: Complemental strand, 23457725 - 23457644
Alignment:
96 cagaagcgtaggctagcaagcactaaac-tagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    |||||| |||||||||||||| |||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||    
23457725 cagaagtgtaggctagcaagcgctaaacctagattgaaaataaacaagtttgcaagcgacaaacttgtgaaaatagggttcc 23457644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 87 - 173
Target Start/End: Complemental strand, 22011524 - 22011436
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||| |||||||||| | ||||||| |||||| ||||| |||||||||||||||||||| |||||||||||||||||||||||    
22011524 gacgcagtacggaagcgtagggttagcaagcgctaaacctagatagaaaagaacaagtttgcaagtgacaaacttgtgaaaatagggtt 22011436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 87 - 173
Target Start/End: Complemental strand, 33655715 - 33655628
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||| |||| ||||| |||||||| |||||| ||||| |||||  |||||||||||||||||||||||||||||||||||||    
33655715 gacgcagtacggaagtgtaggttagcaagcgctaaacctagatagaaaaatacaagtttgcaagcgacaaacttgtgaaaatagggtt 33655628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 87 - 170
Target Start/End: Complemental strand, 2156055 - 2155970
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagg 170  Q
    |||||||||| |||||||||| | ||||||| |||||| ||||| ||||||||||||||||| |||||||||||||||||||||||    
2156055 gacgcagtacggaagcgtagggttagcaagcgctaaacctagatagaaaagaacaagtttgcgagcgacaaacttgtgaaaatagg 2155970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 87 - 174
Target Start/End: Complemental strand, 33051706 - 33051617
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaac-tagattgaaaa-gaacaagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    |||| ||||| ||||| ||||||||||||| |||||| || |||||||| ||||||||||||||||||||||||| ||||||||||||||    
33051706 gacgtagtacggaagcttaggctagcaagcgctaaacctaaattgaaaaagaacaagtttgcaagcgacaaacttttgaaaatagggttc 33051617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 87 - 173
Target Start/End: Original strand, 27956155 - 27956243
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||| |||||||||| | ||||||| |||||| ||||| |||||||||||||||||||||||||||| | |||||||||||||    
27956155 gacgcagtacggaagcgtagggttagcaagcgctaaacctagatagaaaagaacaagtttgcaagcgacaaacctatgaaaatagggtt 27956243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 87 - 173
Target Start/End: Complemental strand, 31636425 - 31636337
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||| |||||||||| | ||||||| |||||| ||||| ||||||||| ||||||||||||||||||||||||||||| ||||    
31636425 gacgcagtacggaagcgtagggttagcaagcgctaaacctagatagaaaagaactagtttgcaagcgacaaacttgtgaaaatatggtt 31636337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 98 - 174
Target Start/End: Original strand, 5171597 - 5171675
Alignment:
98 gaagcgtaggctagcaagcactaaa-ctagattgaaaaga-acaagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    |||||||||| || ||||| ||||| |||||||||||||| ||||||||||||||||||||||||| ||||||||||||    
5171597 gaagcgtaggttaacaagcgctaaatctagattgaaaagagacaagtttgcaagcgacaaacttgtaaaaatagggttc 5171675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 98 - 175
Target Start/End: Complemental strand, 12966553 - 12966475
Alignment:
98 gaagcgtaggctagcaagcactaaa-ctagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    ||||| ||||||||||| |  |||| ||||||||||||||||||||| ||||||||| |||||||||||||||||||||    
12966553 gaagcataggctagcaaacgttaaatctagattgaaaagaacaagttcgcaagcgacgaacttgtgaaaatagggttcc 12966475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 98 - 175
Target Start/End: Complemental strand, 21772451 - 21772373
Alignment:
98 gaagcgtaggctagcaagcactaaact-agattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    |||||||||| |||| | | ||||||| |||||||||| |||||||||||||||||||||||| |||||||||||||||    
21772451 gaagcgtaggttagccaacgctaaacttagattgaaaaaaacaagtttgcaagcgacaaacttatgaaaatagggttcc 21772373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 170 - 239
Target Start/End: Original strand, 27955588 - 27955657
Alignment:
170 ggttccacagacgttggaaacgcttcagtcgtctgagcaacgtcgatctcctcttgcaacggcgtaagaa 239  Q
    |||||||||||||| | ||||||||| |||||| ||||||||||||| ||||||| ||||||||||||||    
27955588 ggttccacagacgtcgaaaacgcttcggtcgtccgagcaacgtcgatatcctctttcaacggcgtaagaa 27955657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 87 - 170
Target Start/End: Complemental strand, 31634192 - 31634107
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagg 170  Q
    |||||||||| |||||||||| | ||||| | |||||| ||||| ||||||||||||||||| |||||||||||||||||||||||    
31634192 gacgcagtacggaagcgtagggttagcaaacgctaaacctagatagaaaagaacaagtttgctagcgacaaacttgtgaaaatagg 31634107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 98 - 168
Target Start/End: Complemental strand, 28737982 - 28737911
Alignment:
98 gaagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaata 168  Q
    ||||||||| ||||||||  |||||| ||||||||||||| |||||||||||||||||||||| ||||||||    
28737982 gaagcgtagtctagcaagtgctaaacctagattgaaaagagcaagtttgcaagcgacaaacttttgaaaata 28737911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 87 - 175
Target Start/End: Complemental strand, 1518280 - 1518191
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    |||||||||| ||||||||  ||||||||| || ||| |||||||||| | ||||||| ||||||||| ||||| |||||||||||||||    
1518280 gacgcagtacggaagcgtatcctagcaagcgcttaacctagattgaaagggacaagttcgcaagcgacgaacttatgaaaatagggttcc 1518191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 98 - 173
Target Start/End: Complemental strand, 4185006 - 4184929
Alignment:
98 gaagcgtaggctagcaagcactaaac-tagattgaaaagaac-aagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    ||||||||||||| |||| ||||||  |||||| |||||||  ||||| |||||||||||||||||||||||||||||    
4185006 gaagcgtaggctaacaagtactaaatatagattcaaaagaaataagttcgcaagcgacaaacttgtgaaaatagggtt 4184929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 32162007 - 32162059
Alignment:
123 ctagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    |||||| |||||||| |||||||||||| ||||||||||||||||||||||||    
32162007 ctagatcgaaaagaaacaagtttgcaagtgacaaacttgtgaaaatagggttc 32162059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 98 - 169
Target Start/End: Complemental strand, 8294655 - 8294582
Alignment:
98 gaagcgtaggctagcaagcactaaact-agattgaa-aagaacaagtttgcaagcgacaaacttgtgaaaatag 169  Q
    ||||| ||||||||||||  ||||||| |||| ||| ||||||| ||||||||||||||||||||| |||||||    
8294655 gaagcataggctagcaagtgctaaacttagatagaagaagaacacgtttgcaagcgacaaacttgtaaaaatag 8294582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 102 - 169
Target Start/End: Complemental strand, 28737910 - 28737841
Alignment:
102 cgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgac-aaacttgtgaaaatag 169  Q
    ||||||||||||||| |||||| || ||||||||||  ||||||||||| ||| ||||||||||||||||    
28737910 cgtaggctagcaagcgctaaacctaaattgaaaagagtaagtttgcaagagacaaaacttgtgaaaatag 28737841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 87 - 173
Target Start/End: Original strand, 32163773 - 32163860
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaac-tagattgaaaagaac-aagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||| |||||||| ||||||| ||||  ||||| ||||||||||||||  ||||||| ||||| |||||||||||||||| ||||    
32163773 gacgcagt-cagaagcgaaggctagaaagcgttaaacctagattgaaaagaaataagtttgtaagcgtcaaacttgtgaaaatatggtt 32163860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 127 - 168
Target Start/End: Complemental strand, 23456622 - 23456580
Alignment:
127 attgaaaagaa-caagtttgcaagcgacaaacttgtgaaaata 168  Q
    ||||||||||| |||||||||||||||||||||| ||||||||    
23456622 attgaaaagaaacaagtttgcaagcgacaaacttttgaaaata 23456580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 123 - 168
Target Start/End: Complemental strand, 2165944 - 2165899
Alignment:
123 ctagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaata 168  Q
    |||||| ||||||||||||||||||||| |||||||| | ||||||    
2165944 ctagatagaaaagaacaagtttgcaagcaacaaacttatcaaaata 2165899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 138 - 174
Target Start/End: Original strand, 12123950 - 12123986
Alignment:
138 caagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    |||||||||||||||||||| |||||||||| |||||    
12123950 caagtttgcaagcgacaaacctgtgaaaatatggttc 12123986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 64; Significance: 6e-28; HSPs: 27)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 87 - 173
Target Start/End: Original strand, 2189723 - 2189810
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||| ||||||||||||||||||| |||||| | ||||||||||||||||||||||||||||||||||||||||||| ||||    
2189723 gacgcagtacggaagcgtaggctagcaagcgctaaacctcgattgaaaagaacaagtttgcaagcgacaaacttgtgaaaataaggtt 2189810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 97 - 171
Target Start/End: Complemental strand, 42890469 - 42890394
Alignment:
97 agaagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaataggg 171  Q
    |||||||||||||||||||| |||||| ||||| ||||||||||||||||||||||||||||||||||||||||||    
42890469 agaagcgtaggctagcaagcgctaaacctagatagaaaagaacaagtttgcaagcgacaaacttgtgaaaataggg 42890394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 87 - 173
Target Start/End: Original strand, 42891665 - 42891753
Alignment:
87 gacgcagtacagaagcgtagg-ctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||| ||| |||||||||| ||||||||| |||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||    
42891665 gacgcaatacggaagcgtagggctagcaagcgctaaacctagatagaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 42891753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 87 - 170
Target Start/End: Complemental strand, 24731120 - 24731035
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaact-agattgaaaag-aacaagtttgcaagcgacaaacttgtgaaaatagg 170  Q
    |||||||||||||| ||||||||||||||| ||||| | ||||||||||| ||||||||||||||| |||||||||||||||||||    
24731120 gacgcagtacagaaccgtaggctagcaagcgctaaatttagattgaaaaggaacaagtttgcaagcaacaaacttgtgaaaatagg 24731035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 87 - 173
Target Start/End: Original strand, 22921851 - 22921939
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||| |||||||||| | ||||||| |||||| ||||| |||||||| |||||||||||||||||||||||||||||||||||    
22921851 gacgcagtacggaagcgtagggttagcaagcgctaaacctagatagaaaagaataagtttgcaagcgacaaacttgtgaaaatagggtt 22921939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 87 - 169
Target Start/End: Complemental strand, 24731315 - 24731231
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaac-tagattgaaaag-aacaagtttgcaagcgacaaacttgtgaaaatag 169  Q
    |||||||||| | ||||||||||||||||| |||||| |||||||||||| ||||||||||||||| ||||||||||||||||||    
24731315 gacgcagtacgggagcgtaggctagcaagcgctaaacctagattgaaaaggaacaagtttgcaagcaacaaacttgtgaaaatag 24731231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 87 - 175
Target Start/End: Complemental strand, 18468736 - 18468647
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    ||||||||||||||||   || |||||||| |||||| ||| | |||||||||||| |||||||||||||||||||||||||||||||||    
18468736 gacgcagtacagaagcaagggttagcaagcgctaaacctaggtagaaaagaacaagcttgcaagcgacaaacttgtgaaaatagggttcc 18468647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 87 - 173
Target Start/End: Complemental strand, 6845424 - 6845336
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||| |||||||||| | ||||||| |||||| ||||| ||||||||||||||| ||||||| ||||||||||||||||||||    
6845424 gacgcagtacggaagcgtagggttagcaagcgctaaacctagatagaaaagaacaagtttacaagcgataaacttgtgaaaatagggtt 6845336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 87 - 173
Target Start/End: Original strand, 22512047 - 22512135
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||| |||| ||||| | ||||||| |||||| ||| | ||||||||||||||||||||||||||||||||||||||||||||    
22512047 gacgcagtacggaagtgtagggttagcaagcgctaaacctaggtagaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 22512135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 87 - 173
Target Start/End: Original strand, 22519347 - 22519435
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||| |||| ||||| | ||||||| |||||| ||| | ||||||||||||||||||||||||||||||||||||||||||||    
22519347 gacgcagtacggaagtgtagggttagcaagcgctaaacctaggtagaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 22519435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 87 - 173
Target Start/End: Original strand, 22926649 - 22926737
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||| ||||| |||||||||| | || |||| |||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||    
22926649 gacgtagtacggaagcgtagggttagaaagcgctaaacctagatagaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 22926737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 87 - 173
Target Start/End: Complemental strand, 37189954 - 37189866
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaa-ctagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||| ||||| |||| | ||||||| ||||| |||||| |||||||| |||||||||||||||||||||||||||||||||||    
37189954 gacgcagtacggaagcttagggttagcaagctctaaaactagatagaaaagaataagtttgcaagcgacaaacttgtgaaaatagggtt 37189866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 170 - 241
Target Start/End: Complemental strand, 42891048 - 42890977
Alignment:
170 ggttccacagacgttggaaacgcttcagtcgtctgagcaacgtcgatctcctcttgcaacggcgtaagaatt 241  Q
    |||| ||||||||| ||||||||||| |||||| ||||||||||||||||||||| ||||| ||||||||||    
42891048 ggtttcacagacgtcggaaacgcttcggtcgtccgagcaacgtcgatctcctctttcaacgtcgtaagaatt 42890977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 109 - 173
Target Start/End: Complemental strand, 23570649 - 23570584
Alignment:
109 tagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||| |||||| ||||| ||||||||||||||||||||||||||||||||||||||| ||||    
23570649 tagcaagcgctaaacctagatagaaaagaacaagtttgcaagcgacaaacttgtgaaaataaggtt 23570584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 131 - 174
Target Start/End: Complemental strand, 2687784 - 2687741
Alignment:
131 aaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
2687784 aaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttc 2687741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 170 - 241
Target Start/End: Complemental strand, 23571151 - 23571081
Alignment:
170 ggttccacagacgttggaaacgcttcagtcgtctgagcaacgtcgatctcctcttgcaacggcgtaagaatt 241  Q
    ||||||||| |||| |||||||||||||||||| ||| | ||||||||||||||| ||||||||||||||||    
23571151 ggttccaca-acgtcggaaacgcttcagtcgtccgagaagcgtcgatctcctctttcaacggcgtaagaatt 23571081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 99 - 173
Target Start/End: Complemental strand, 26374975 - 26374900
Alignment:
99 aagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    ||||||| ||||||||||  ||| | |||||||||||||||||||| ||||||||||||||||| |||||||||||    
26374975 aagcgtaagctagcaagcgttaagcctagattgaaaagaacaagttcgcaagcgacaaacttgtaaaaatagggtt 26374900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 170 - 241
Target Start/End: Original strand, 42891109 - 42891180
Alignment:
170 ggttccacagacgttggaaacgcttcagtcgtctgagcaacgtcgatctcctcttgcaacggcgtaagaatt 241  Q
    |||| ||||||||| ||||||||||| |||||  ||||||||||||||||||||| ||||| ||||||||||    
42891109 ggtttcacagacgtcggaaacgcttcggtcgtacgagcaacgtcgatctcctctttcaacgtcgtaagaatt 42891180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 123 - 173
Target Start/End: Complemental strand, 23573633 - 23573583
Alignment:
123 ctagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||| ||||| ||||||||| ||||||||||||||||||||||||||||    
23573633 ctagatagaaaataacaagtttacaagcgacaaacttgtgaaaatagggtt 23573583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 109 - 176
Target Start/End: Complemental strand, 16598315 - 16598246
Alignment:
109 tagcaagcactaaact-agattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttcca 176  Q
    |||||||| ||||||| |||||  |||||| |||||||||| ||||||||||||||||||||||||||||    
16598315 tagcaagcgctaaacttagattagaaagaaacaagtttgcacgcgacaaacttgtgaaaatagggttcca 16598246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 109 - 173
Target Start/End: Original strand, 22520823 - 22520888
Alignment:
109 tagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||| |||||| ||| | ||||||| ||||||||||||||||||| ||||||||||||||||    
22520823 tagcaagcgctaaacctaggtagaaaagatcaagtttgcaagcgacaaatttgtgaaaatagggtt 22520888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 87 - 143
Target Start/End: Complemental strand, 26378088 - 26378031
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaa-ctagattgaaaagaacaagtt 143  Q
    |||| ||||| ||||||||||||||||||| ||||| |||||||||||||||||||||    
26378088 gacgtagtacggaagcgtaggctagcaagcgctaaatctagattgaaaagaacaagtt 26378031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 125 - 175
Target Start/End: Complemental strand, 2689195 - 2689144
Alignment:
125 agattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    ||||||||||||| |||||||||||||||||||  |||||||||||||||||    
2689195 agattgaaaagaaacaagtttgcaagcgacaaaactgtgaaaatagggttcc 2689144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 98 - 175
Target Start/End: Complemental strand, 14130242 - 14130163
Alignment:
98 gaagcgtaggctagcaagcactaaa-ctagattgaaaaga-acaagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    |||||||||||| ||||||  |||| |||||| ||||||| |||||||||||||||| ||| ||||||||||| ||||||    
14130242 gaagcgtaggcttgcaagcgttaaatctagatcgaaaagagacaagtttgcaagcgataaatttgtgaaaataaggttcc 14130163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 98 - 175
Target Start/End: Complemental strand, 20693876 - 20693797
Alignment:
98 gaagcgtaggctagcaagcactaaac-tagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    ||||||||||||||| ||   ||||| ||||||||||| || ||||||||||||||||||| ||||||||||| ||||||    
20693876 gaagcgtaggctagcgagggttaaacctagattgaaaataaacaagtttgcaagcgacaaatttgtgaaaatatggttcc 20693797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 136 - 173
Target Start/End: Original strand, 2609547 - 2609584
Alignment:
136 aacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||||||| |||||||||||||||||||||||    
2609547 aacaagtttgcaagtgacaaacttgtgaaaatagggtt 2609584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 87 - 123
Target Start/End: Original strand, 18180714 - 18180750
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaac 123  Q
    |||||||||| ||||||||||||||||||| ||||||    
18180714 gacgcagtacggaagcgtaggctagcaagcgctaaac 18180750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 22)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 87 - 175
Target Start/End: Complemental strand, 31915637 - 31915548
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaact-agattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    |||| ||||| |||||| |||||||||||||||||||| || ||||||  ||||||||||||||||||||||||||||||||||||||||    
31915637 gacgtagtacggaagcgcaggctagcaagcactaaacttaggttgaaagaaacaagtttgcaagcgacaaacttgtgaaaatagggttcc 31915548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 87 - 173
Target Start/End: Complemental strand, 8931308 - 8931220
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||| |||||||||| | ||||||| |||||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||    
8931308 gacgcagtacggaagcgtagggttagcaagcgctaaacctagattgaaaaaaacaagtttgcaagcgataaacttgtgaaaatagggtt 8931220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 12944192 - 12944115
Alignment:
99 aagcgtaggctagcaagcactaaa-ctagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    |||||||||||||||||| ||||| ||||||||||||||| ||||||||||| |||||||||||| ||||||||||||    
12944192 aagcgtaggctagcaagcgctaaatctagattgaaaagaaacaagtttgcaaacgacaaacttgtaaaaatagggttc 12944115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 87 - 173
Target Start/End: Original strand, 50857445 - 50857533
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||| |||||||||| | ||||||| |||||| ||||| |||||||| ||||||| |||||||||||||||||||||||||||    
50857445 gacgcagtacggaagcgtagggttagcaagcgctaaacctagatagaaaagaataagtttgtaagcgacaaacttgtgaaaatagggtt 50857533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 112 - 170
Target Start/End: Original strand, 13444015 - 13444074
Alignment:
112 caagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagg 170  Q
    |||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||    
13444015 caagcactaaacctagatagaaaagaacaagtttgcaagcgacaaacttgtgaaaatagg 13444074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 98 - 175
Target Start/End: Original strand, 28660758 - 28660837
Alignment:
98 gaagcgtaggctagcaagcactaaac-tagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    |||||||||| |||||| | |||||| ||||| || ||||| ||||||||||||||||||||||||||||||||||||||    
28660758 gaagcgtaggatagcaaacgctaaacctagatagataagaaacaagtttgcaagcgacaaacttgtgaaaatagggttcc 28660837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 31913454 - 31913375
Alignment:
97 agaagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    |||||| ||||||||||||| |||||| ||| ||||||  |||||||||||||||||||||||||| |||||||| ||||    
31913454 agaagcataggctagcaagcgctaaacctaggttgaaagaaacaagtttgcaagcgacaaacttgtaaaaataggtttcc 31913375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 176 - 241
Target Start/End: Original strand, 13443411 - 13443476
Alignment:
176 acagacgttggaaacgcttcagtcgtctgagcaacgtcgatctcctcttgcaacggcgtaagaatt 241  Q
    ||||| |||| ||||||||| |||||| ||||||||||||||||||||| ||||| ||||||||||    
13443411 acagatgttgaaaacgcttcggtcgtcagagcaacgtcgatctcctctttcaacgtcgtaagaatt 13443476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 98 - 173
Target Start/End: Complemental strand, 9031094 - 9031017
Alignment:
98 gaagcgtaggctagcaagcactaaac-tagattgaaaag-aacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||||||||||| ||||||| || ||||||||| || |||||||||||| | |||||| |||||||||||||    
9031094 gaagcgtaggctagcaagtactaaacctatattgaaaaggaataagtttgcaagcaataaacttatgaaaatagggtt 9031017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 87 - 166
Target Start/End: Original strand, 40058103 - 40058184
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaa-ctagattgaaaag-aacaagtttgcaagcgacaaacttgtgaaaa 166  Q
    ||||| |||| |||||||||||||||||||| |||| ||| || |||||| || ||||||||||||||||||||| ||||||    
40058103 gacgcggtacggaagcgtaggctagcaagcagtaaacctaaatagaaaagaaataagtttgcaagcgacaaacttatgaaaa 40058184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 102 - 173
Target Start/End: Complemental strand, 50713786 - 50713713
Alignment:
102 cgtaggctagcaagcactaaac-tagattgaaaaga-acaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    ||||||||| ||| | |||||| ||||||||||||| ||||||| ||| |||||||||||||||||||||||||    
50713786 cgtaggctaacaaccgctaaacctagattgaaaagagacaagttcgcaggcgacaaacttgtgaaaatagggtt 50713713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 131 - 166
Target Start/End: Complemental strand, 10927234 - 10927199
Alignment:
131 aaaagaacaagtttgcaagcgacaaacttgtgaaaa 166  Q
    ||||||||||||||||||||||||||||||||||||    
10927234 aaaagaacaagtttgcaagcgacaaacttgtgaaaa 10927199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 102 - 169
Target Start/End: Complemental strand, 43681535 - 43681465
Alignment:
102 cgtaggctagcaagcactaaac-tagattgaaaagaa--caagtttgcaagcgacaaacttgtgaaaatag 169  Q
    |||| |||||||||| |||||| ||||||||||| ||  ||||||||||||||||||| ||||||||||||    
43681535 cgtatgctagcaagcgctaaacctagattgaaaaaaaaacaagtttgcaagcgacaaatttgtgaaaatag 43681465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 98 - 174
Target Start/End: Complemental strand, 10925814 - 10925739
Alignment:
98 gaagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    |||||| |||||||||||| |||||| || ||||||||  |||| |||||||||||||||||||| |||||| |||||    
10925814 gaagcggaggctagcaagcgctaaacctaaattgaaaa--acaattttgcaagcgacaaacttgtaaaaatatggttc 10925739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 98 - 173
Target Start/End: Complemental strand, 10928366 - 10928289
Alignment:
98 gaagcgtaggctagcaagcactaaac-tagattgaaaaga-acaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    ||||||||||||||||||  |||||| |||||| |||||| | ||||||| ||| |||||||||||||||||| ||||    
10928366 gaagcgtaggctagcaagtgctaaacctagattaaaaagatataagtttgtaagtgacaaacttgtgaaaataaggtt 10928289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 98 - 173
Target Start/End: Original strand, 28661080 - 28661157
Alignment:
98 gaagcgtaggctagcaagcactaaac-tagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    ||||||||||||||||||  |||||| || ||||| ||||| ||||||||||||||| |||| ||| |||||||||||    
28661080 gaagcgtaggctagcaagtgctaaacctaaattgataagaaacaagtttgcaagcgaaaaacctgtaaaaatagggtt 28661157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 123 - 175
Target Start/End: Original strand, 33152757 - 33152810
Alignment:
123 ctagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    ||||||||||||||| ||||||||||||||||||||||  || |||||||||||    
33152757 ctagattgaaaagaaacaagtttgcaagcgacaaacttacgacaatagggttcc 33152810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 98 - 168
Target Start/End: Complemental strand, 23987653 - 23987581
Alignment:
98 gaagcgtaggctagcaagcactaaac-tagattgaaaa-gaacaagtttgcaagcgacaaacttgtgaaaata 168  Q
    |||||||||| |||||||| || ||| ||||| ||||| |||||| ||||||| |||||||||||||||||||    
23987653 gaagcgtagggtagcaagcgctgaacctagatagaaaaagaacaactttgcaaacgacaaacttgtgaaaata 23987581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 98 - 175
Target Start/End: Complemental strand, 239764 - 239685
Alignment:
98 gaagcgtaggctagcaagcactaaact-agattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    ||||||||||||||||||  ||||||| | ||| ||||||| |||||| ||||||| |||| || |||||||||||||||    
239764 gaagcgtaggctagcaagggctaaacttatattaaaaagaaacaagttagcaagcgtcaaatttatgaaaatagggttcc 239685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 101 - 174
Target Start/End: Complemental strand, 8221562 - 8221487
Alignment:
101 gcgtaggctagcaagcactaaacta-gattgaaaaga-acaagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    |||||||||||| ||  |||||| | ||||||| ||| |||||||||||| |||||||||| ||||||||||||||    
8221562 gcgtaggctagctagtgctaaaccaagattgaatagagacaagtttgcaaacgacaaacttatgaaaatagggttc 8221487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 130 - 176
Target Start/End: Original strand, 8967850 - 8967896
Alignment:
130 gaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttcca 176  Q
    |||||||||||||||||||  ||||||| | ||||||||||||||||    
8967850 gaaaagaacaagtttgcaaatgacaaacctatgaaaatagggttcca 8967896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 123 - 168
Target Start/End: Complemental strand, 26981561 - 26981516
Alignment:
123 ctagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaata 168  Q
    |||||||||||  ||||||||||||||||| |||||||| ||||||    
26981561 ctagattgaaagaaacaagtttgcaagcgaaaaacttgtaaaaata 26981516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 57; Significance: 9e-24; HSPs: 29)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 87 - 173
Target Start/End: Original strand, 13882687 - 13882775
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||| |||||||||| | ||||||| |||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||    
13882687 gacgcagtacggaagcgtagggttagcaagcgctaaacctagatagaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 13882775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 87 - 170
Target Start/End: Complemental strand, 5934691 - 5934607
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaac-tagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagg 170  Q
    |||||||| ||||||||||||||||||||| |||||| |||||||||||||| ||| |||||||||||||||||||||||||||||    
5934691 gacgcagt-cagaagcgtaggctagcaagcgctaaacctagattgaaaagaaacaaatttgcaagcgacaaacttgtgaaaatagg 5934607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 87 - 170
Target Start/End: Original strand, 13886160 - 13886245
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagg 170  Q
    |||||||||| |||||||||| | ||||||| |||||| ||||| |||||||||||||||||||||||||||||||||||||||||    
13886160 gacgcagtacggaagcgtagggttagcaagcgctaaacctagatagaaaagaacaagtttgcaagcgacaaacttgtgaaaatagg 13886245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 90 - 174
Target Start/End: Complemental strand, 30217898 - 30217814
Alignment:
90 gcagtacagaagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    |||||| |||||||||||||||||||| |||||| |||||||||| ||||||||| ||||||||||||||||||||||||| ||||    
30217898 gcagtatagaagcgtaggctagcaagcgctaaacctagattgaaa-gaacaagttcgcaagcgacaaacttgtgaaaatagagttc 30217814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 87 - 173
Target Start/End: Original strand, 859157 - 859245
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||| ||| |||||||||| | ||||||| |||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||    
859157 gacgcaatacggaagcgtaggattagcaagcgctaaacctagatagaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 859245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 87 - 173
Target Start/End: Original strand, 1217161 - 1217249
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||| ||| |||||||||| | ||||||| |||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||    
1217161 gacgcaatacggaagcgtaggattagcaagcgctaaacctagatagaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 1217249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 98 - 175
Target Start/End: Original strand, 3778721 - 3778799
Alignment:
98 gaagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    ||||||||||||  |||||||||||  |||||||||| |||||||||||||||||| ||||||||||||||||||||||    
3778721 gaagcgtaggctgacaagcactaaatatagattgaaatgaacaagtttgcaagcgagaaacttgtgaaaatagggttcc 3778799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 87 - 175
Target Start/End: Original strand, 4888687 - 4888776
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    |||||| ||| |||||||||||||||| || || ||| ||||| |||||||||||||||||||||||||||| ||||||||||| |||||    
4888687 gacgcaatacggaagcgtaggctagcatgcgctgaacctagatagaaaagaacaagtttgcaagcgacaaacctgtgaaaatagagttcc 4888776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 99 - 176
Target Start/End: Complemental strand, 1883565 - 1883486
Alignment:
99 aagcgtaggctagcaagcactaaac-tagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttcca 176  Q
    ||||||| |||||||| |||||||| |||||||||||||| ||||||||||| ||||||||||||||||||| |||||||    
1883565 aagcgtatgctagcaaacactaaacctagattgaaaagaaacaagtttgcaaacgacaaacttgtgaaaataaggttcca 1883486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 109 - 174
Target Start/End: Original strand, 27309638 - 27309705
Alignment:
109 tagcaagcactaaac-tagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    |||||||| |||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||    
27309638 tagcaagcgctaaacctagattgaaaagaaacaagtttgcaagcgacaaacttgtgaaaatagggttc 27309705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 98 - 174
Target Start/End: Original strand, 11000838 - 11000916
Alignment:
98 gaagcgtaggctagcaagcactaaac-tagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    |||| |||||||||||||| |||||| |||||||||||||| |||||| |||||||||||||| |||||||||||||||    
11000838 gaagtgtaggctagcaagcgctaaacctagattgaaaagaaacaagttcgcaagcgacaaactagtgaaaatagggttc 11000916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 104 - 176
Target Start/End: Complemental strand, 1365742 - 1365669
Alignment:
104 taggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttcca 176  Q
    ||||||||||||| |||||| |||||||||| ||||||||||| ||||||  ||||||||||||||||||||||    
1365742 taggctagcaagcgctaaacctagattgaaaggaacaagtttgtaagcgatgaacttgtgaaaatagggttcca 1365669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 123 - 175
Target Start/End: Complemental strand, 24840194 - 24840141
Alignment:
123 ctagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
24840194 ctagattgaaaagaaacaagtttgcaagcgacaaacttgtgaaaatagggttcc 24840141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 123 - 175
Target Start/End: Complemental strand, 27142717 - 27142664
Alignment:
123 ctagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
27142717 ctagattgaaaagaaacaagtttgcaagcgacaaacttgtgaaaatagggttcc 27142664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 98 - 175
Target Start/End: Complemental strand, 1369882 - 1369803
Alignment:
98 gaagcgtaggctagcaagcactaaac-tagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    |||||| ||||||||||||  ||||| |||||||||||||| ||||||||||||||| |||||||| |||||||||||||    
1369882 gaagcggaggctagcaagcgttaaacctagattgaaaagaaacaagtttgcaagcgataaacttgttaaaatagggttcc 1369803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 87 - 174
Target Start/End: Complemental strand, 1874626 - 1874537
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaac-tagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    |||| ||||| |||||||| | |||||| |||||||| | |||||||||||| ||||||||||| ||||||||||||||||||| |||||    
1874626 gacgtagtacggaagcgtatgttagcaaacactaaaccttgattgaaaagaaacaagtttgcaaacgacaaacttgtgaaaataaggttc 1874537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 92 - 173
Target Start/End: Original strand, 1220446 - 1220529
Alignment:
92 agtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||||||||| | ||||| | |||||| || || |||| |||||||||||||| ||||||||||||||||||||||||    
1220446 agtacagaagcgtagggttagcaaacgctaaacctacatagaaatgaacaagtttgcaaacgacaaacttgtgaaaatagggtt 1220529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 1753640 - 1753690
Alignment:
127 attgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttcca 176  Q
    ||||||||||| |||||||||||||||||||||||||||||||| ||||||    
1753640 attgaaaagaaacaagtttgcaagcgacaaacttgtgaaaatagagttcca 1753690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 166
Target Start/End: Original strand, 8063842 - 8063885
Alignment:
123 ctagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaa 166  Q
    |||||||||||||||||||||||||||||| ||| |||||||||    
8063842 ctagattgaaaagaacaagtttgcaagcgataaatttgtgaaaa 8063885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 98 - 174
Target Start/End: Original strand, 4133286 - 4133364
Alignment:
98 gaagcgtaggctagcaagcactaaact-agattgaaaa-gaacaagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    |||||||||||||||||   ||||||| |||||||| | |||||| ||| |||||||||||||||||||||||| ||||    
4133286 gaagcgtaggctagcaaatgctaaacttagattgaagatgaacaaattttcaagcgacaaacttgtgaaaatagagttc 4133364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 87 - 175
Target Start/End: Original strand, 7803032 - 7803122
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaac-tagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    |||||||||| |||||||||| |||||||   ||||| ||| | |||||||| ||||||||||||| |||||||| |||||||| ||||||    
7803032 gacgcagtacggaagcgtaggttagcaagggttaaacctaggtcgaaaagaaacaagtttgcaagcaacaaacttatgaaaataaggttcc 7803122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 11229032 - 11228978
Alignment:
123 ctagattgaaaa-gaacaagtttgcaagcgacaaacttgtgaaaatagggttcca 176  Q
    |||||||||||| ||||||||||||| ||||||||| |||||||| |||||||||    
11229032 ctagattgaaaaagaacaagtttgcaggcgacaaacgtgtgaaaaaagggttcca 11228978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 131 - 176
Target Start/End: Complemental strand, 1786725 - 1786680
Alignment:
131 aaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttcca 176  Q
    |||| |||||||||||||||||||||| || |||||||||||||||    
1786725 aaaataacaagtttgcaagcgacaaacatgcgaaaatagggttcca 1786680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 98 - 173
Target Start/End: Original strand, 6451762 - 6451839
Alignment:
98 gaagcgtaggctagcaagcactaaa-ctagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||| | |||| ||||| ||||| ||||||||||| ||| |||||||||||||||||||| |||||||||| ||||    
6451762 gaagcgaaagctatcaagcgctaaatctagattgaaaggaaacaagtttgcaagcgacaaacctgtgaaaataaggtt 6451839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 94 - 175
Target Start/End: Complemental strand, 13466812 - 13466729
Alignment:
94 tacagaagcgtaggctagcaagcactaaac-tagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    |||||||| |||| ||||||||| |||||| || ||| ||||||| |||||||||||   |||||||| |||||||||||||||    
13466812 tacagaagagtagcctagcaagcgctaaacctatattaaaaagaaacaagtttgcaaaaaacaaacttatgaaaatagggttcc 13466729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 108 - 174
Target Start/End: Complemental strand, 35814937 - 35814870
Alignment:
108 ctagcaagcactaaa-ctagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    ||||||| ||||||| |||||||||||  | ||| |||||||||||||||||||| |||||| |||||    
35814937 ctagcaaacactaaatctagattgaaagaaccaactttgcaagcgacaaacttgtaaaaataaggttc 35814870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 136 - 174
Target Start/End: Complemental strand, 11228758 - 11228720
Alignment:
136 aacaagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    |||||||||| |||||||||||||||| |||||||||||    
11228758 aacaagtttggaagcgacaaacttgtggaaatagggttc 11228720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 87 - 174
Target Start/End: Original strand, 8916379 - 8916467
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaac-tagattgaaaa-gaacaagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    |||||||| |||||||||| ||||| ||||  ||||| |||||| |||| |||||||||||||| ||| ||||||||| |||||| ||||    
8916379 gacgcagt-cagaagcgtatgctagtaagcgttaaacctagatttaaaatgaacaagtttgcaaacgataaacttgtggaaatagagttc 8916467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 170
Target Start/End: Original strand, 13886245 - 13886274
Alignment:
141 gtttgcaagcgacaaacttgtgaaaatagg 170  Q
    ||||||||||||||||||||||||||||||    
13886245 gtttgcaagcgacaaacttgtgaaaatagg 13886274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 57; Significance: 9e-24; HSPs: 21)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 87 - 173
Target Start/End: Complemental strand, 3536122 - 3536034
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||| |||||||||| | ||||||| |||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||    
3536122 gacgcagtacggaagcgtagggttagcaagcgctaaacctagatagaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 3536034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 87 - 173
Target Start/End: Complemental strand, 3542333 - 3542245
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||| |||||||||| | ||||||| |||||| ||||| |||||||||||||||| |||||||||||||||||||||||||||    
3542333 gacgcagtacggaagcgtagggttagcaagcgctaaacctagatagaaaagaacaagtttgtaagcgacaaacttgtgaaaatagggtt 3542245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 101 - 169
Target Start/End: Complemental strand, 11659005 - 11658936
Alignment:
101 gcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatag 169  Q
    ||||||| ||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||    
11659005 gcgtaggttagcaagcactaaacctagattgaaaagaacaaatttgcaagcgataaacttgtgaaaatag 11658936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 94 - 168
Target Start/End: Original strand, 8048974 - 8049049
Alignment:
94 tacagaagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaata 168  Q
    |||||||||||||||||||||||| ||| | |||||| ||||||| ||||||||||| ||||||||||||||||||    
8048974 tacagaagcgtaggctagcaagcattaatcctagattaaaaagaaaaagtttgcaagtgacaaacttgtgaaaata 8049049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 87 - 175
Target Start/End: Original strand, 27822119 - 27822209
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaac-tagattgaaaag-aacaagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    |||||||||| ||||||||||||||||| | |||||| || || |||||| ||||||||| ||||||||||||||||||||| ||||||||    
27822119 gacgcagtacggaagcgtaggctagcaaacgctaaacctaaatagaaaaggaacaagttttcaagcgacaaacttgtgaaaacagggttcc 27822209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 104 - 175
Target Start/End: Complemental strand, 14238507 - 14238434
Alignment:
104 taggctagcaagcactaaac-tagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    ||||||||||| |||||||| || ||||||||||| ||||||||||||||||||||||||||||||| ||||||    
14238507 taggctagcaaacactaaacataaattgaaaagaaacaagtttgcaagcgacaaacttgtgaaaataaggttcc 14238434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 90 - 173
Target Start/End: Original strand, 29340810 - 29340895
Alignment:
90 gcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    ||||||| |||||||||| | |||| || |||||| ||||| ||||| ||||||||||||||||||||||||||||||||||||||    
29340810 gcagtacggaagcgtagggttagcaggcgctaaacctagatagaaaaaaacaagtttgcaagcgacaaacttgtgaaaatagggtt 29340895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 87 - 169
Target Start/End: Complemental strand, 30050004 - 30049920
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatag 169  Q
    |||||||||| |||||| ||| | ||||||| |||||| || || ||||||||||||||||||||||||||||||||||||||||    
30050004 gacgcagtacggaagcgaagggttagcaagcgctaaacctatatagaaaagaacaagtttgcaagcgacaaacttgtgaaaatag 30049920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 87 - 173
Target Start/End: Original strand, 33615505 - 33615593
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaac-tagattgaaaa-gaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||| ||| ||| ||||||||| ||||| | |||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||    
33615505 gacgcattacggaaacgtaggctaacaagcgcaaaacctagatagaaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 33615593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 30052253 - 30052207
Alignment:
123 ctagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatag 169  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||    
30052253 ctagatagaaaagaacaagtttgcaagcgacaaacttgtgaaaatag 30052207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 98 - 166
Target Start/End: Complemental strand, 18727184 - 18727115
Alignment:
98 gaagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaa 166  Q
    ||||||||||||||||| | |||||| |||||||||||  ||||||| ||||||||||||||||||||||    
18727184 gaagcgtaggctagcaaacgctaaacctagattgaaaaacacaagttcgcaagcgacaaacttgtgaaaa 18727115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 98 - 173
Target Start/End: Complemental strand, 12882200 - 12882123
Alignment:
98 gaagcgtaggctagcaagcactaaac-tagattgaaaaga-acaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    ||||||||| ||||||| |||| ||| |||||||| |||| ||||||||  |||||||||||||||||||||||||||    
12882200 gaagcgtagactagcaaacactgaacctagattgagaagagacaagttttaaagcgacaaacttgtgaaaatagggtt 12882123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 87 - 166
Target Start/End: Original strand, 18718201 - 18718279
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaa-ctagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaa 166  Q
    ||||||||||||||| |||||||||||||| ||||| ||||||||||||  |||| || ||||  ||||||||||||||||    
18718201 gacgcagtacagaagtgtaggctagcaagcgctaaacctagattgaaaaagacaaattcgcaa--gacaaacttgtgaaaa 18718279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 90 - 165
Target Start/End: Complemental strand, 22889345 - 22889268
Alignment:
90 gcagtacagaagcgtaggctagcaagcactaaa-ctagattgaaaaga-acaagtttgcaagcgacaaacttgtgaaa 165  Q
    |||||||||||||||||||||||||||  |||| |||||||||||| | |||||||||||  |||||||||| |||||    
22889345 gcagtacagaagcgtaggctagcaagctttaaacctagattgaaaaaagacaagtttgcattcgacaaacttatgaaa 22889268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 90 - 165
Target Start/End: Complemental strand, 22910887 - 22910810
Alignment:
90 gcagtacagaagcgtaggctagcaagcactaaa-ctagattgaaaaga-acaagtttgcaagcgacaaacttgtgaaa 165  Q
    |||||||||||||||||||||||||||  |||| |||||||||||| | |||||||||||  |||||||||| |||||    
22910887 gcagtacagaagcgtaggctagcaagctttaaacctagattgaaaaaagacaagtttgcattcgacaaacttatgaaa 22910810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 106 - 169
Target Start/End: Complemental strand, 1127323 - 1127258
Alignment:
106 ggctagcaagcactaaac-tagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatag 169  Q
    ||||||| ||| |||||| |||||| ||||||| ||||||||||||||||||| ||||||||||||    
1127323 ggctagcgagcgctaaacctagattaaaaagaaacaagtttgcaagcgacaaatttgtgaaaatag 1127258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 88 - 120
Target Start/End: Original strand, 8047390 - 8047422
Alignment:
88 acgcagtacagaagcgtaggctagcaagcacta 120  Q
    |||||||||||||||||||||||||||||||||    
8047390 acgcagtacagaagcgtaggctagcaagcacta 8047422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 241
Target Start/End: Original strand, 8048395 - 8048451
Alignment:
185 ggaaacgcttcagtcgtctgagcaacgtcgatctcctcttgcaacggcgtaagaatt 241  Q
    ||||||||||| ||||||   ||||||||||||||||||| || |||||||||||||    
8048395 ggaaacgcttcggtcgtccttgcaacgtcgatctcctctttcagcggcgtaagaatt 8048451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 90 - 165
Target Start/End: Complemental strand, 22873897 - 22873822
Alignment:
90 gcagtacagaagcgtaggctagcaagcactaaac-tagattgaaaaga-acaagtttgcaagcgacaaacttgtgaaa 165  Q
    ||||||||||  ||||||||||||||   ||||| || |||||||||| ||||||||||| |||||||||||||||||    
22873897 gcagtacaga--cgtaggctagcaagtgttaaacctaaattgaaaagagacaagtttgcatgcgacaaacttgtgaaa 22873822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 131 - 176
Target Start/End: Original strand, 24443118 - 24443163
Alignment:
131 aaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttcca 176  Q
    ||||||||| | ||||||||||||||||| | ||||||||||||||    
24443118 aaaagaacaggcttgcaagcgacaaacttataaaaatagggttcca 24443163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 123 - 167
Target Start/End: Original strand, 33215201 - 33215246
Alignment:
123 ctagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaat 167  Q
    ||||||| ||||||| |||||||||||||||||||| |||||||||    
33215201 ctagattaaaaagaaacaagtttgcaagcgacaaacctgtgaaaat 33215246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 57; Significance: 9e-24; HSPs: 11)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 87 - 173
Target Start/End: Complemental strand, 5128997 - 5128909
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    ||||||||||||||||||||| | |||| || |||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||    
5128997 gacgcagtacagaagcgtagggttagcaggcgctaaacctagatagaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 5128909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 87 - 173
Target Start/End: Original strand, 43303961 - 43304049
Alignment:
87 gacgcagtacagaagcgta-ggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||| |||||||| || |||||||| |||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||    
43303961 gacgcagtacggaagcgtaaggttagcaagcgctaaacctagatagaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 43304049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 87 - 173
Target Start/End: Original strand, 43306673 - 43306761
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||| |||||||||| | ||||||| |||||| ||||| ||||||||||||||||||||| ||||||||||||||||||||||    
43306673 gacgcagtacggaagcgtagggttagcaagcgctaaacctagatagaaaagaacaagtttgcaagcaacaaacttgtgaaaatagggtt 43306761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 87 - 175
Target Start/End: Original strand, 2472690 - 2472779
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    ||||||||||  |||||||||||||||||| |||||| || |||||||   |||||||||||| ||||||||||||||||||||||||||    
2472690 gacgcagtacgaaagcgtaggctagcaagcgctaaacctaaattgaaagagacaagtttgcaaccgacaaacttgtgaaaatagggttcc 2472779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 170 - 241
Target Start/End: Original strand, 43306216 - 43306287
Alignment:
170 ggttccacagacgttggaaacgcttcagtcgtctgagcaacgtcgatctcctcttgcaacggcgtaagaatt 241  Q
    |||| ||||||||| ||||||||||| |||||| ||||||||||||||||||||| ||||| ||||||||||    
43306216 ggtttcacagacgtcggaaacgcttcggtcgtccgagcaacgtcgatctcctctttcaacgtcgtaagaatt 43306287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 87 - 173
Target Start/End: Original strand, 3063738 - 3063826
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    ||||||||||  ||||||||| | |||||||  ||||| ||||| ||||||||  ||||||||||||||||||||||||||||||||||    
3063738 gacgcagtacgaaagcgtagggttagcaagcgttaaacctagatagaaaagaaagagtttgcaagcgacaaacttgtgaaaatagggtt 3063826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 87 - 173
Target Start/End: Original strand, 3068876 - 3068964
Alignment:
87 gacgcagtacagaagcgta-ggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||| |||||||| || |||||||| |||||| ||||| ||||||||||||||||||||  | |||||||| |||||||||||    
3068876 gacgcagtacggaagcgtatggttagcaagcgctaaacctagatagaaaagaacaagtttgcaaggaaaaaacttgtaaaaatagggtt 3068964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 87 - 174
Target Start/End: Original strand, 365594 - 365682
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    |||||| ||| ||||||||||||||||| | |||||| || |  ||||| ||||| ||  |||||||||||||||||||||||||||||    
365594 gacgcattacggaagcgtaggctagcaaacgctaaacctaaaaagaaaataacaaattcccaagcgacaaacttgtgaaaatagggttc 365682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 98 - 176
Target Start/End: Complemental strand, 33175912 - 33175832
Alignment:
98 gaagcgtaggctagcaagcactaaac-tagattgaaaaga-acaagtttgcaagcgacaaacttgtgaaaatagggttcca 176  Q
    ||||||||||||||||| |  ||||| || |||||||||| ||||||||||||  ||||||||| ||||||||||||||||    
33175912 gaagcgtaggctagcaaacgataaacctatattgaaaagagacaagtttgcaaaggacaaacttatgaaaatagggttcca 33175832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 98 - 176
Target Start/End: Complemental strand, 52708921 - 52708841
Alignment:
98 gaagcgtaggctagcaagcactaaac-tagattgaaaa-gaacaagtttgcaagcgacaaacttgtgaaaatagggttcca 176  Q
    |||||||||| || ||||| |||||| ||||| ||||| |||||| ||||||||||| |||||||||||| ||||||||||    
52708921 gaagcgtaggttaacaagcgctaaacctagatagaaaaagaacaaatttgcaagcgataaacttgtgaaagtagggttcca 52708841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 166
Target Start/End: Original strand, 45168358 - 45168401
Alignment:
123 ctagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaa 166  Q
    |||||||||||  |||||||||||||||||||||||||||||||    
45168358 ctagattgaaataaacaagtttgcaagcgacaaacttgtgaaaa 45168401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 54; Significance: 6e-22; HSPs: 8)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 86 - 173
Target Start/End: Original strand, 21848965 - 21849054
Alignment:
86 cgacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    ||||||||||| |||||||||| | ||||||| | |||| ||||| ||||||||||||||||||||||||||||||||||||||||||||    
21848965 cgacgcagtacggaagcgtagggttagcaagcgccaaacctagatagaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 21849054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 131 - 175
Target Start/End: Original strand, 19497351 - 19497395
Alignment:
131 aaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
19497351 aaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttcc 19497395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 87 - 173
Target Start/End: Original strand, 40778787 - 40778875
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||| |||||| ||| | | ||||| |||||| ||||| |||||||||||||||||||||||||||||||| |||||||||||    
40778787 gacgcagtacggaagcgcagggttaacaagcgctaaacctagatagaaaagaacaagtttgcaagcgacaaacttgtaaaaatagggtt 40778875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 104 - 173
Target Start/End: Complemental strand, 492638 - 492567
Alignment:
104 taggctagcaagcactaaact-agattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    ||||||||||||| ||||| | ||||||||||||| ||||||||||||||||||||||||||| ||||||||    
492638 taggctagcaagcgctaaatttagattgaaaagaaacaagtttgcaagcgacaaacttgtgaagatagggtt 492567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 98 - 176
Target Start/End: Complemental strand, 22440934 - 22440855
Alignment:
98 gaagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttcca 176  Q
    ||||||||||||||||||  |||||| ||||| |||||||||| ||| ||||||||||||||| ||| ||||||||||||    
22440934 gaagcgtaggctagcaagtgctaaacctagatagaaaagaacatgttcgcaagcgacaaacttatgataatagggttcca 22440855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 134 - 174
Target Start/End: Complemental strand, 18252455 - 18252415
Alignment:
134 agaacaagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    |||||||||||||||||||||||| ||||||||||||||||    
18252455 agaacaagtttgcaagcgacaaacctgtgaaaatagggttc 18252415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 98 - 174
Target Start/End: Complemental strand, 26140420 - 26140342
Alignment:
98 gaagcgtaggctagcaagcactaaa-ctagattgaaa-agaacaagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    ||||| |||| |||||| | ||||| ||||||||||| | |||||| ||||||||||||||||| ||||||||||||||    
26140420 gaagcataggttagcaaacgctaaatctagattgaaagaaaacaagattgcaagcgacaaacttatgaaaatagggttc 26140342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 127 - 175
Target Start/End: Original strand, 9868447 - 9868496
Alignment:
127 attgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    ||||||||||| ||||||| ||||| ||||||||||||||||||||||||    
9868447 attgaaaagaaacaagtttacaagcaacaaacttgtgaaaatagggttcc 9868496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0054 (Bit Score: 49; Significance: 5e-19; HSPs: 3)
Name: scaffold0054
Description:

Target: scaffold0054; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 99 - 170
Target Start/End: Complemental strand, 37786 - 37714
Alignment:
99 aagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagg 170  Q
    ||||||| ||||| |||| |||||| |||||||||||||||||||||||||||||||||||| ||||||||||    
37786 aagcgtaagctagaaagcgctaaacctagattgaaaagaacaagtttgcaagcgacaaacttatgaaaatagg 37714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0054; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 49372 - 49319
Alignment:
123 ctagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttcca 176  Q
    ||||||||| ||||||||||||||||||||||||||| ||||||||||||||||    
49372 ctagattgagaagaacaagtttgcaagcgacaaacttatgaaaatagggttcca 49319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0054; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 90 - 165
Target Start/End: Complemental strand, 10740 - 10663
Alignment:
90 gcagtacagaagcgtaggctagcaagcactaaa-ctagattgaaaaga-acaagtttgcaagcgacaaacttgtgaaa 165  Q
    |||||||||||||||||||||||||||  |||| |||||||||||| | |||||||||||  |||||||||| |||||    
10740 gcagtacagaagcgtaggctagcaagctttaaacctagattgaaaaaagacaagtttgcattcgacaaacttatgaaa 10663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0531 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0531
Description:

Target: scaffold0531; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 94 - 168
Target Start/End: Original strand, 11597 - 11672
Alignment:
94 tacagaagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaata 168  Q
    |||||||||||||||||||||||| ||| | |||||| ||||||| ||||||||||| ||||||||||||||||||    
11597 tacagaagcgtaggctagcaagcattaatcctagattaaaaagaaaaagtttgcaagtgacaaacttgtgaaaata 11672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0251 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0251
Description:

Target: scaffold0251; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 87 - 175
Target Start/End: Complemental strand, 9791 - 9700
Alignment:
87 gacgcagtacagaagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgac--aaacttgtgaaaatagggttcc 175  Q
    |||||| || ||||||||| ||||||||||  ||||| ||||||||||||||||||||| ||||||||  | ||||||||||||||||||||    
9791 gacgcattatagaagcgtatgctagcaagcggtaaacctagattgaaaagaacaagtttccaagcgactaacacttgtgaaaatagggttcc 9700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0110 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: scaffold0110
Description:

Target: scaffold0110; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 87 - 157
Target Start/End: Original strand, 46734 - 46806
Alignment:
87 gacgcagtacagaagcgtaggct-agcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaac 157  Q
    |||||||||| |||||||||| | ||||||| |||||| ||||| ||||||||||||||||||||||||||||    
46734 gacgcagtacggaagcgtagggtgagcaagcgctaaacctagatagaaaagaacaagtttgcaagcgacaaac 46806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0110; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 132 - 173
Target Start/End: Original strand, 45310 - 45351
Alignment:
132 aaagaacaagtttgcaagcgacaaacttgtgaaaatagggtt 173  Q
    |||||||||||||||||||||||||||| |||||||| ||||    
45310 aaagaacaagtttgcaagcgacaaacttatgaaaataaggtt 45351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0240 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 3)
Name: scaffold0240
Description:

Target: scaffold0240; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 97 - 170
Target Start/End: Complemental strand, 14924 - 14850
Alignment:
97 agaagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagg 170  Q
    |||||||||||||||||||| |||||| | ||||||||  || ||||| |||||||| |||||||||||||||||    
14924 agaagcgtaggctagcaagcgctaaaccttgattgaaataaataagttggcaagcgaaaaacttgtgaaaatagg 14850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0240; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 107 - 174
Target Start/End: Complemental strand, 1725 - 1657
Alignment:
107 gctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    ||||||||||  ||||| ||||||||||  ||||||||||||| |||||||||||| |||||| |||||    
1725 gctagcaagcgttaaacctagattgaaagaaacaagtttgcaaacgacaaacttgtcaaaatatggttc 1657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0240; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 102 - 169
Target Start/End: Complemental strand, 16119 - 16051
Alignment:
102 cgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatag 169  Q
    ||||||||| ||||  |||||| ||||| |||||||||||||||||||| ||||||| | |||||||||    
16119 cgtaggctaacaagtgctaaacctagatagaaaagaacaagtttgcaagtgacaaacatctgaaaatag 16051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 98 - 174
Target Start/End: Complemental strand, 145811 - 145733
Alignment:
98 gaagcgtaggctagcaagcactaaac-tagattgaaaagaa-caagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    |||| ||| |||||||| | |||||| ||||||||||| || |||||||||||||||||| ||||| ||||||||||||    
145811 gaagtgtaagctagcaatcgctaaacctagattgaaaaaaatcaagtttgcaagcgacaagcttgtaaaaatagggttc 145733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0236 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0236
Description:

Target: scaffold0236; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 16473 - 16396
Alignment:
99 aagcgtaggctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttcc 175  Q
    ||||||||| ||| || |||||||| |||||| |||| ||  ||||||||||||||||||||| |||||||| |||||    
16473 aagcgtaggttagtaaacactaaacctagattaaaaaaaatgagtttgcaagcgacaaacttgagaaaatagagttcc 16396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0330 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0330
Description:

Target: scaffold0330; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 107 - 174
Target Start/End: Complemental strand, 17707 - 17639
Alignment:
107 gctagcaagcactaaac-tagattgaaaagaacaagtttgcaagcgacaaacttgtgaaaatagggttc 174  Q
    ||||||||||  ||||| ||||||||||  ||||||||||||| |||||||||||| |||||| |||||    
17707 gctagcaagcgttaaacctagattgaaagaaacaagtttgcaaacgacaaacttgtcaaaatatggttc 17639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 199113 times since January 2019
Visitors: 2774