View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_low_37 (Length: 326)

Name: NF0945_low_37
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0945_low_37
NF0945_low_37
[»] chr3 (13 HSPs)
chr3 (1-295)||(50241389-50241664)
chr3 (159-285)||(2250895-2251020)
chr3 (159-285)||(14045308-14045434)
chr3 (159-285)||(20790232-20790357)
chr3 (159-285)||(39184079-39184205)
chr3 (159-285)||(40057690-40057816)
chr3 (165-202)||(20935037-20935074)
chr3 (165-202)||(32976511-32976548)
chr3 (165-202)||(42400423-42400460)
chr3 (171-202)||(50332005-50332036)
chr3 (102-134)||(14249271-14249303)
chr3 (170-202)||(17764130-17764162)
chr3 (170-202)||(19065450-19065482)
[»] chr4 (6 HSPs)
chr4 (1-294)||(6554451-6554725)
chr4 (1-294)||(314233-314507)
chr4 (170-285)||(35695942-35696059)
chr4 (171-202)||(13228701-13228732)
chr4 (93-137)||(24180967-24181011)
chr4 (22-70)||(35696136-35696184)
[»] scaffold0211 (1 HSPs)
scaffold0211 (1-294)||(18355-18629)
[»] scaffold0114 (1 HSPs)
scaffold0114 (1-290)||(36954-37224)
[»] chr5 (5 HSPs)
chr5 (1-294)||(9024862-9025136)
chr5 (159-285)||(30327039-30327164)
chr5 (159-286)||(23570626-23570752)
chr5 (171-202)||(38015979-38016010)
chr5 (204-285)||(27593551-27593632)
[»] chr8 (9 HSPs)
chr8 (13-293)||(41526946-41527205)
chr8 (159-285)||(360967-361092)
chr8 (165-285)||(40886775-40886896)
chr8 (159-285)||(45245232-45245358)
chr8 (167-202)||(38290543-38290578)
chr8 (147-197)||(17871244-17871294)
chr8 (171-201)||(42797332-42797362)
chr8 (171-199)||(13756548-13756576)
chr8 (152-199)||(14373895-14373940)
[»] chr2 (7 HSPs)
chr2 (1-294)||(31965745-31966017)
chr2 (165-202)||(19040706-19040743)
chr2 (165-202)||(39839128-39839165)
chr2 (170-202)||(36720075-36720107)
chr2 (150-201)||(14905103-14905154)
chr2 (204-285)||(24968967-24969048)
chr2 (92-137)||(45054785-45054830)
[»] chr1 (11 HSPs)
chr1 (1-293)||(49881712-49881987)
chr1 (159-285)||(19102761-19102886)
chr1 (230-294)||(45918340-45918404)
chr1 (159-285)||(21467720-21467845)
chr1 (165-202)||(1992431-1992468)
chr1 (165-202)||(20306773-20306810)
chr1 (165-202)||(40946528-40946565)
chr1 (165-202)||(30001782-30001819)
chr1 (170-202)||(43387145-43387177)
chr1 (173-202)||(3982731-3982760)
chr1 (173-201)||(47783156-47783184)
[»] scaffold0284 (1 HSPs)
scaffold0284 (1-285)||(731-996)
[»] chr6 (8 HSPs)
chr6 (159-285)||(21986190-21986315)
chr6 (159-285)||(33348201-33348326)
chr6 (165-202)||(7428525-7428562)
chr6 (165-201)||(16279120-16279156)
chr6 (165-201)||(28365735-28365771)
chr6 (171-202)||(1599691-1599722)
chr6 (175-220)||(9449661-9449706)
chr6 (147-212)||(16705606-16705671)
[»] scaffold1345 (1 HSPs)
scaffold1345 (165-202)||(1857-1894)
[»] chr7 (2 HSPs)
chr7 (165-202)||(43989691-43989728)
chr7 (92-132)||(6198481-6198521)
[»] scaffold1750 (1 HSPs)
scaffold1750 (165-202)||(324-361)


Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 13)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 295
Target Start/End: Complemental strand, 50241664 - 50241389
Alignment:
1 ttacactgagtattatcaccatattagactaagagataccatacaagtgagataaatatcacatattcacacaaaactttaagccagtagtatgtaaatg 100  Q
    ||||| ||||| |||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||| |||    
50241664 ttacagtgagttttatcaccatattagactaagagataccatacaagtgagattgatatcacatattcacacaaaactttaagccagtagtatgtatatg 50241565  T
101 agtcatctcacttatatgttattcataatctactcttatatccataatttactcttatatccactataaaattttaactcacacttgacacattaacatc 200  Q
    |||||||||||||||||||||||||||||                   |||||||||||||||||||| ||||||||||||||||||||||||||||||     
50241564 agtcatctcacttatatgttattcataat-------------------ttactcttatatccactatagaattttaactcacacttgacacattaacatt 50241484  T
201 tcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaaggttggttaa 295  Q
    |  ||||||||||||||||||||| ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
50241483 ttttattcaagtttgcaactctctgtgtccataattacgtgacatagtcaaataatatcaaatgaagacaccatatgtttaaaaaggttggttaa 50241389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 159 - 285
Target Start/End: Complemental strand, 2251020 - 2250895
Alignment:
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| |||||| |||||||||| |||||||||||||||||||| ||||||| |||||||||||| |||| ||||||||||||| |||||| ||||| ||    
2251020 atccaatataaatttttaactcatacttgacacattaacatctcttattcaaatttgcaactctc-ctgttcataattacgtgatatagtcaaataagat 2250922  T
259 caaatgaagacaccatatgtttaaaaa 285  Q
    |||| ||| | || |||||||||||||    
2250921 caaaggaaaatacaatatgtttaaaaa 2250895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 159 - 285
Target Start/End: Complemental strand, 14045434 - 14045308
Alignment:
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| ||||||||||||||||||||| |||||||||||| ||| ||||||| ||||||| ||||| ||| ||||||||||||| |||||| ||||  ||    
14045434 atccaatataaaattttaactcacactcgacacattaacacctcttattcaaatttgcaagtctctgtgtccataattacgtgatatagtcaaatatgat 14045335  T
259 caaatgaagacaccatatgtttaaaaa 285  Q
    |||| ||||| || |||||||||||||    
14045334 caaaggaagatacaatatgtttaaaaa 14045308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 159 - 285
Target Start/End: Complemental strand, 20790357 - 20790232
Alignment:
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| |||||| |||||||||| |||||||||||||||| ||| ||||||| |||||||||||| |||| ||||||||||||| |||||| ||||| ||    
20790357 atccaatataaatttttaactcatacttgacacattaacacctcttattcaaatttgcaactctc-ctgttcataattacgtgatatagtcaaataagat 20790259  T
259 caaatgaagacaccatatgtttaaaaa 285  Q
     ||| ||||| || |||||||||||||    
20790258 taaaggaagatacaatatgtttaaaaa 20790232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 159 - 285
Target Start/End: Complemental strand, 39184205 - 39184079
Alignment:
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| |||||| ||| ||| ||||||||||||||| | | ||| ||||||| ||||||||||||| ||| |||||||| |||| |||||| ||||| ||    
39184205 atccaatataaactttaaacccacacttgacacatttatacctcttattcaaatttgcaactctctgtgtccataattatgtgatatagtcaaataagat 39184106  T
259 caaatgaagacaccatatgtttaaaaa 285  Q
    |||| |||||  | |||||||||||||    
39184105 caaaggaagatgcaatatgtttaaaaa 39184079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 159 - 285
Target Start/End: Complemental strand, 40057816 - 40057690
Alignment:
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| |||||| |||||||||||| ||||| |||| | | ||||||||||| ||||||||||||| ||| | |||||| |||| |||||| ||||| ||    
40057816 atccaatataaatttttaactcacatttgactcatttatacctcctattcaaatttgcaactctctgtgtccctaattatgtgatatagtcaaataagat 40057717  T
259 caaatgaagacaccatatgtttaaaaa 285  Q
    |||| |||||  | |||||||||||||    
40057716 caaaggaagatgcaatatgtttaaaaa 40057690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 202
Target Start/End: Original strand, 20935037 - 20935074
Alignment:
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
    |||||||||||||||||||| |||||||||||||||||    
20935037 tataaaattttaactcacacctgacacattaacatctc 20935074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 202
Target Start/End: Original strand, 32976511 - 32976548
Alignment:
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
    |||||||||||||||||||||||| |||||||||||||    
32976511 tataaaattttaactcacacttgatacattaacatctc 32976548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 202
Target Start/End: Original strand, 42400423 - 42400460
Alignment:
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
    |||||||||||||||||||| |||||||||||||||||    
42400423 tataaaattttaactcacacgtgacacattaacatctc 42400460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 171 - 202
Target Start/End: Original strand, 50332005 - 50332036
Alignment:
171 attttaactcacacttgacacattaacatctc 202  Q
    ||||||||||||||||||||||||||||||||    
50332005 attttaactcacacttgacacattaacatctc 50332036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 134
Target Start/End: Original strand, 14249271 - 14249303
Alignment:
102 gtcatctcacttatatgttattcataatctact 134  Q
    ||||||||||||||||||| |||||||||||||    
14249271 gtcatctcacttatatgtttttcataatctact 14249303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 170 - 202
Target Start/End: Complemental strand, 17764162 - 17764130
Alignment:
170 aattttaactcacacttgacacattaacatctc 202  Q
    |||||||||||||||||| ||||||||||||||    
17764162 aattttaactcacacttgtcacattaacatctc 17764130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 170 - 202
Target Start/End: Complemental strand, 19065482 - 19065450
Alignment:
170 aattttaactcacacttgacacattaacatctc 202  Q
    |||||||||||||||||| ||||||||||||||    
19065482 aattttaactcacacttgtcacattaacatctc 19065450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 171; Significance: 8e-92; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 1 - 294
Target Start/End: Complemental strand, 6554725 - 6554451
Alignment:
1 ttacactgagtattatcaccatattagactaagagataccatacaagtgagataaatatcacatattcacacaaaactttaagccagtagtatgtaaatg 100  Q
    ||||||||||| |||||||||||||||||||||||||||||||||| ||||||  |||||||||||||||||||||| |||||||||||||||||| |||    
6554725 ttacactgagttttatcaccatattagactaagagataccatacaattgagattgatatcacatattcacacaaaaccttaagccagtagtatgtatatg 6554626  T
101 agtcatctcacttatatgttattcataatctactcttatatccataatttactcttatatccactataaaattttaactcacacttgacacattaacatc 200  Q
    ||||||||||||||||||||||||| |||||||||||    ||||               |||||||| |||||||||||||||||||||||||||||||    
6554625 agtcatctcacttatatgttattcaaaatctactctt----ccat---------------ccactatagaattttaactcacacttgacacattaacatc 6554545  T
201 tcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaaggttggtta 294  Q
    || ||||||||||||||||||||| ||| |||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| ||||    
6554544 tcttattcaagtttgcaactctctgtgtccataattacgtgacatagtcaaataatatcaaatgaagacaccatatatttaaaaaggttagtta 6554451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 1 - 294
Target Start/End: Complemental strand, 314507 - 314233
Alignment:
1 ttacactgagtattatcaccatattagactaagagataccatacaagtgagataaatatcacatattcacacaaaactttaagccagtagtatgtaaatg 100  Q
    ||||||||||| |||||||||||||||||||||||||| ||||||||||||||  |||||||||||||||||||||| |||||||||| ||||||| |||    
314507 ttacactgagttttatcaccatattagactaagagatatcatacaagtgagattgatatcacatattcacacaaaacattaagccagtggtatgtatatg 314408  T
101 agtcatctcacttatatgttattcataatctactcttatatccataatttactcttatatccactataaaattttaactcacacttgacacattaacatc 200  Q
    ||||||||||||||||||||||||| ||||||||||| |||                   |||| ||| ||||||||||||| |||||||||||||||||    
314407 agtcatctcacttatatgttattcaaaatctactcttctat-------------------ccaccatagaattttaactcacgcttgacacattaacatc 314327  T
201 tcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaaggttggtta 294  Q
    || ||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
314326 tcttattcaagtttgcaactctctgtgtccataattacgtgacatagtcaaataatatcaaatgaagacaccatatgtttaaaaaggttggtta 314233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 170 - 285
Target Start/End: Complemental strand, 35696059 - 35695942
Alignment:
170 aattttaactcacacttgacaca--ttaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaag 267  Q
    |||||||||||||||||||||||  |||||||||  |||| |||||||||||||||  ||| ||||||||||||||||  || ||||| || |||||||     
35696059 aattttaactcacacttgacacacattaacatctattatttaagtttgcaactctccgtgtccataattacgtgacatgttcaaataagataaaatgaaa 35695960  T
268 acaccatatgtttaaaaa 285  Q
    ||   |||||||||||||    
35695959 acgtaatatgtttaaaaa 35695942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 171 - 202
Target Start/End: Complemental strand, 13228732 - 13228701
Alignment:
171 attttaactcacacttgacacattaacatctc 202  Q
    ||||||||||||||||||||||||||||||||    
13228732 attttaactcacacttgacacattaacatctc 13228701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 93 - 137
Target Start/End: Original strand, 24180967 - 24181011
Alignment:
93 tgtaaatgagtcatctcacttatatgttattcataatctactctt 137  Q
    |||| |||||| || ||||||||||||||||||| ||||||||||    
24180967 tgtatatgagttatttcacttatatgttattcatcatctactctt 24181011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 22 - 70
Target Start/End: Complemental strand, 35696184 - 35696136
Alignment:
22 tattagactaagagataccatacaagtgagataaatatcacatattcac 70  Q
    |||||||| |||||||| || |||||||||||  |||||||||||||||    
35696184 tattagaccaagagatatcacacaagtgagattgatatcacatattcac 35696136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0211 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: scaffold0211
Description:

Target: scaffold0211; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 1 - 294
Target Start/End: Original strand, 18355 - 18629
Alignment:
1 ttacactgagtattatcaccatattagactaagagataccatacaagtgagataaatatcacatattcacacaaaactttaagccagtagtatgtaaatg 100  Q
    ||||||||| | |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||| ||||||| |||||||||| |||    
18355 ttacactgaattttatcaccatattagactaagagataccatacaagtgagattgatatcacatattcacacaaaaccttaagcctgtagtatgtatatg 18454  T
101 agtcatctcacttatatgttattcataatctactcttatatccataatttactcttatatccactataaaattttaactcacacttgacacattaacatc 200  Q
    ||||||||||||||||||||||||| ||||||||||| |||                   |||||||| ||||||||||||||||||||  |||||||||    
18455 agtcatctcacttatatgttattcaaaatctactcttctat-------------------ccactatagaattttaactcacacttgactaattaacatc 18535  T
201 tcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaaggttggtta 294  Q
    || ||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
18536 tcttattcaagtttgcaactctctgtgtccataattacgtgacatagtcaaataatatcaaatgaagacaccatatgtttaaaaaggttggtta 18629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0114 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: scaffold0114
Description:

Target: scaffold0114; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 1 - 290
Target Start/End: Complemental strand, 37224 - 36954
Alignment:
1 ttacactgagtattatcaccatattagactaagagataccatacaagtgagataaatatcacatattcacacaaaactttaagccagtagtatgtaaatg 100  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||| |||||| ||||||||||| |||    
37224 ttacactgagttttatcaccatattagactaagagataccatacaagtgagattgatatcacatattcacacaaaaccttaagctagtagtatgtatatg 37125  T
101 agtcatctcacttatatgttattcataatctactcttatatccataatttactcttatatccactataaaattttaactcacacttgacacattaacatc 200  Q
    | ||||||||||||||||||||||| ||||||||||| |||                   |||||||| |||||||||||||||||||||||||||||||    
37124 aatcatctcacttatatgttattcaaaatctactcttctat-------------------ccactatagaattttaactcacacttgacacattaacatc 37044  T
201 tcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaaggttg 290  Q
    || ||||||||||||||||||||| ||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||    
37043 tcttattcaagtttgcaactctctgtgtccataattacgtgacgtagtcaaataatatcaaatgaagacaccatatgtttaaaaaggttg 36954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 164; Significance: 1e-87; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 294
Target Start/End: Complemental strand, 9025136 - 9024862
Alignment:
1 ttacactgagtattatcaccatattagactaagagataccatacaagtgagataaatatcacatattcacacaaaactttaagccagtagtatgtaaatg 100  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||| |||||||||||||||||| |||    
9025136 ttacactgagttttatcaccatattagactaagagataccatacaagtgagattgatatcacatattcacacaaaaccttaagccagtagtatgtatatg 9025037  T
101 agtcatctcacttatatgttattcataatctactcttatatccataatttactcttatatccactataaaattttaactcacacttgacacattaacatc 200  Q
    ||||||||||||||||||||||||| |||||||                   |||| ||||||||||| |||||||||||||||||||||||||||||||    
9025036 agtcatctcacttatatgttattcaaaatctac-------------------tcttctatccactatataattttaactcacacttgacacattaacatc 9024956  T
201 tcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaaggttggtta 294  Q
    || ||||||| ||||||||||| | | | |||||||||||||||||||| |||||||||||| |||||||||||||||||||||| ||||||||    
9024955 tcttattcaattttgcaactctttttatccataattacgtgacatagtcaaataatatcaaacgaagacaccatatgtttaaaaaagttggtta 9024862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 159 - 285
Target Start/End: Original strand, 30327039 - 30327164
Alignment:
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| |||||| |||||||||| |||||||||||||||| ||| ||||||| |||||||||||| |||| ||||||||||||| |||||| ||||| ||    
30327039 atccaatataaatttttaactcatacttgacacattaacacctcttattcaaatttgcaactctc-ctgttcataattacgtgatatagtcaaataagat 30327137  T
259 caaatgaagacaccatatgtttaaaaa 285  Q
    |||| ||||| || |||||||||||||    
30327138 caaaggaagatacaatatgtttaaaaa 30327164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 159 - 286
Target Start/End: Original strand, 23570626 - 23570752
Alignment:
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| |||||| |||||||||| |||||||||||||||| ||| ||||||| ||||||||||| | ||| ||||||||||||| |||||| ||||| ||    
23570626 atccaatataaatttttaactcatacttgacacattaacacctcttattcaaatttgcaactct-tatgttcataattacgtgatatagtcaaataagat 23570724  T
259 caaatgaagacaccatatgtttaaaaag 286  Q
    |||| ||||| || ||||||| ||||||    
23570725 caaaggaagatacaatatgttaaaaaag 23570752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 171 - 202
Target Start/End: Original strand, 38015979 - 38016010
Alignment:
171 attttaactcacacttgacacattaacatctc 202  Q
    ||||||||||||||||||||||||||||||||    
38015979 attttaactcacacttgacacattaacatctc 38016010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 204 - 285
Target Start/End: Original strand, 27593551 - 27593632
Alignment:
204 tattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaa 285  Q
    ||||||| ||||||||||| | ||| ||||| || |||| |||||| ||||| |||||| |||||  | |||||||||||||    
27593551 tattcaaatttgcaactctatgtgtccataactatgtgatatagtcaaataagatcaaaggaagatgcaatatgtttaaaaa 27593632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 152; Significance: 2e-80; HSPs: 9)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 13 - 293
Target Start/End: Original strand, 41526946 - 41527205
Alignment:
13 ttatcaccatattagactaagagataccatacaagtgagataaatatcacatattcacacaaaactttaagccagtagtatgtaaatgagtcatctcact 112  Q
    ||||||||||||||||||||||  |||||||||||||||||  |||||||||||||||||||||| |||||||||||||||||| |||||||||||||||    
41526946 ttatcaccatattagactaaga--taccatacaagtgagattgatatcacatattcacacaaaaccttaagccagtagtatgtatatgagtcatctcact 41527043  T
113 tatatgttattcataatctactcttatatccataatttactcttatatccactataaaattttaactcacacttgacacattaacatctcctattcaagt 212  Q
    ||||||||||||| ||||||||||| |||                   |||||||| ||||||||||||||||||||||||||| ||||| |||||||||    
41527044 tatatgttattcaaaatctactcttctat-------------------ccactatagaattttaactcacacttgacacattaatatctcttattcaagt 41527124  T
213 ttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaaggttggtt 293  Q
    |||||||||||| ||| ||||||||||||||||||||  ||||||||||||||||||||||||| ||||||||||||||||    
41527125 ttgcaactctctgtgttcataattacgtgacatagtcagataatatcaaatgaagacaccatatatttaaaaaggttggtt 41527205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 159 - 285
Target Start/End: Complemental strand, 361092 - 360967
Alignment:
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| |||||| |||||||||| |||||||||||||||| ||| ||||||| |||||||||||| |||| ||||||||||||| |||||| ||||| ||    
361092 atccaatataaatttttaactcatacttgacacattaacacctcttattcaaatttgcaactctc-ctgttcataattacgtgatatagtcaaataagat 360994  T
259 caaatgaagacaccatatgtttaaaaa 285  Q
    |||| ||||| || |||||||||||||    
360993 caaaagaagatacaatatgtttaaaaa 360967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 165 - 285
Target Start/End: Complemental strand, 40886896 - 40886775
Alignment:
165 tataaaattttaactcacactt-gacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaat 263  Q
    |||||| ||||||||||||||| |||||||| | | ||| ||||||| ||||||||||||| ||| || ||||| |||| |||||| ||||| ||||||     
40886896 tataaatttttaactcacacttagacacatttatacctcttattcaaatttgcaactctctgtgtccacaattatgtgatatagtcaaataagatcaaag 40886797  T
264 gaagacaccatatgtttaaaaa 285  Q
    |||||  | |||||||||||||    
40886796 gaagatgcaatatgtttaaaaa 40886775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 159 - 285
Target Start/End: Complemental strand, 45245358 - 45245232
Alignment:
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| |||||| ||||||||||||||||||||||| |   ||| ||||||  ||||||||||| | | | |||||||| |||| |||||  ||||| ||    
45245358 atccaatataaatttttaactcacacttgacacatttattcctcttattcagatttgcaactctttgtatccataattatgtgatatagttaaataagat 45245259  T
259 caaatgaagacaccatatgtttaaaaa 285  Q
    |||| |||||    |||||||||||||    
45245258 caaaggaagatgtaatatgtttaaaaa 45245232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 202
Target Start/End: Complemental strand, 38290578 - 38290543
Alignment:
167 taaaattttaactcacacttgacacattaacatctc 202  Q
    ||||||| ||||||||||||||||||||||||||||    
38290578 taaaattataactcacacttgacacattaacatctc 38290543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 147 - 197
Target Start/End: Complemental strand, 17871294 - 17871244
Alignment:
147 atttactcttatatccactataaaattttaactcacacttgacacattaac 197  Q
    ||||||||||| || || | ||||| |||||||||||||||||||||||||    
17871294 atttactcttacattcaatgtaaaactttaactcacacttgacacattaac 17871244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 201
Target Start/End: Original strand, 42797332 - 42797362
Alignment:
171 attttaactcacacttgacacattaacatct 201  Q
    |||||||||||||||||||||||||||||||    
42797332 attttaactcacacttgacacattaacatct 42797362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 171 - 199
Target Start/End: Complemental strand, 13756576 - 13756548
Alignment:
171 attttaactcacacttgacacattaacat 199  Q
    |||||||||||||||||||||||||||||    
13756576 attttaactcacacttgacacattaacat 13756548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 152 - 199
Target Start/End: Complemental strand, 14373940 - 14373895
Alignment:
152 ctcttatatccactataaaattttaactcacacttgacacattaacat 199  Q
    |||||||||||| | |||||||||||||  ||||||||||||||||||    
14373940 ctcttatatccaatttaaaattttaact--cacttgacacattaacat 14373895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 149; Significance: 1e-78; HSPs: 7)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 1 - 294
Target Start/End: Original strand, 31965745 - 31966017
Alignment:
1 ttacactgagtattatcaccatattagactaagagataccatacaagtgagataaatatcacatattcacacaaaactttaagccagtagtatgtaaatg 100  Q
    ||||||||||| |||||||||||||||||||||||||| ||||||||||||||  |||||||||||||||||||||| ||||| || ||||||||| |||    
31965745 ttacactgagttttatcaccatattagactaagagatatcatacaagtgagattgatatcacatattcacacaaaaccttaagtcaatagtatgtatatg 31965844  T
101 agtcatctcacttatatgttattcataatctactcttatatccataatttactcttatatccactataaaattttaactcacacttgacacattaacatc 200  Q
      ||||||||||||||||||||||| ||||||||||| |||                   | |||||| |||||||||||| ||||||||||||||| ||    
31965845 --tcatctcacttatatgttattcaaaatctactcttctat-------------------ctactatagaattttaactcatacttgacacattaacttc 31965923  T
201 tcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaaggttggtta 294  Q
    || ||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
31965924 tcttattcaagtttgcaactctctgtgtccataattacgtgacatagtcaaataatatcaaatgaagacaccatatgtttaaaaaggttggtta 31966017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 202
Target Start/End: Complemental strand, 19040743 - 19040706
Alignment:
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
    ||||||||||||||||||||||||||||||||||||||    
19040743 tataaaattttaactcacacttgacacattaacatctc 19040706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 202
Target Start/End: Original strand, 39839128 - 39839165
Alignment:
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
    ||||||||||||||||||||||||||||||||||||||    
39839128 tataaaattttaactcacacttgacacattaacatctc 39839165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 170 - 202
Target Start/End: Complemental strand, 36720107 - 36720075
Alignment:
170 aattttaactcacacttgacacattaacatctc 202  Q
    |||||||||||||||||||||||||||||||||    
36720107 aattttaactcacacttgacacattaacatctc 36720075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 150 - 201
Target Start/End: Complemental strand, 14905154 - 14905103
Alignment:
150 tactcttatatccactataaaattttaactcacacttgacacattaacatct 201  Q
    |||||||  ||||| ||||||| ||||||||||||||||||||| |||||||    
14905154 tactctttcatccaatataaaactttaactcacacttgacacatcaacatct 14905103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 204 - 285
Target Start/End: Complemental strand, 24969048 - 24968967
Alignment:
204 tattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaa 285  Q
    ||||||| ||||||||||| | ||| |||||||| || | |||||| ||||| |||||| |||||  | |||||||||||||    
24969048 tattcaaatttgcaactctatgtgtccataattatgtaatatagtcaaataagatcaaaggaagatgcaatatgtttaaaaa 24968967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 92 - 137
Target Start/End: Original strand, 45054785 - 45054830
Alignment:
92 atgtaaatgagtcatctcacttatatgttattcataatctactctt 137  Q
    ||||| ||||||||| |||||| |||||||||||| ||||||||||    
45054785 atgtatatgagtcatttcacttgtatgttattcatgatctactctt 45054830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 141; Significance: 6e-74; HSPs: 11)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 1 - 293
Target Start/End: Complemental strand, 49881987 - 49881712
Alignment:
1 ttacactgagtattatcaccatattagactaagagataccatacaagtgagataaatatcacatattcacacaaaactttaagccagtagtatgtaaatg 100  Q
    ||||||||||| ||||||||||||||||||| |||||||||||||||||||||  |||||||||||||||||||||| |||||||| ||||||||| |||    
49881987 ttacactgagttttatcaccatattagactacgagataccatacaagtgagattgatatcacatattcacacaaaaccttaagccaatagtatgtatatg 49881888  T
101 agtcatctcacttatatgttattcataatctactcttatatccataatttactcttatatccactataaaattttaactcacacttgacacattaacatc 200  Q
    ||||||||||||||||||||||||| ||||| ||||| ||||||                 |  |||| |||||||||| |||||| |||||||||||||    
49881887 agtcatctcacttatatgttattcaaaatcttctcttctatcca-----------------ctatatagaattttaacttacacttaacacattaacatc 49881805  T
201 tcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaaggttggtt 293  Q
     | ||||||||||||||||||||| ||| ||| ||||| |||||||||| ||||||||||||||||||||||||| |||||||| ||||||||    
49881804 gcttattcaagtttgcaactctctgtgtccatgattacatgacatagtcaaataatatcaaatgaagacaccatacgtttaaaacggttggtt 49881712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 159 - 285
Target Start/End: Original strand, 19102761 - 19102886
Alignment:
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| |||||| |||||||||| |||||||||||||||| ||| ||||||| |||||||||||| |||| ||||||||||||| |||||| ||||| ||    
19102761 atccaatataaatttttaactcatacttgacacattaacacctcttattcaaatttgcaactctc-ctgttcataattacgtgatatagtcaaataagat 19102859  T
259 caaatgaagacaccatatgtttaaaaa 285  Q
    |||| ||||| || |||||||||||||    
19102860 caaaggaagatacaatatgtttaaaaa 19102886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 230 - 294
Target Start/End: Original strand, 45918340 - 45918404
Alignment:
230 cataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaaggttggtta 294  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||    
45918340 cataattacgtgacatagtcaaataatatcaaatgaagacaccatatgtttaaaaaggttagtta 45918404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 159 - 285
Target Start/End: Original strand, 21467720 - 21467845
Alignment:
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| |||||| |||||||||| |||||||| ||||||| ||| ||||||| |||| |||||||  ||| ||||||||||||| |||||| ||||| ||    
21467720 atccaatataaatttttaactcatacttgacaaattaacacctcttattcaaatttgtaactctca-tgttcataattacgtgatatagtcaaataagat 21467818  T
259 caaatgaagacaccatatgtttaaaaa 285  Q
    |||| ||||| || |||||||||||||    
21467819 caaaggaagatacaatatgtttaaaaa 21467845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 202
Target Start/End: Complemental strand, 1992468 - 1992431
Alignment:
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
    ||||||||||||||||||||||||||||||||||||||    
1992468 tataaaattttaactcacacttgacacattaacatctc 1992431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 202
Target Start/End: Original strand, 20306773 - 20306810
Alignment:
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
    ||||||||||||||||||||||||||||||||||||||    
20306773 tataaaattttaactcacacttgacacattaacatctc 20306810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 202
Target Start/End: Complemental strand, 40946565 - 40946528
Alignment:
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
    ||||||||||||||||||||||||||||||||||||||    
40946565 tataaaattttaactcacacttgacacattaacatctc 40946528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 202
Target Start/End: Original strand, 30001782 - 30001819
Alignment:
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
    ||||||||||||||| ||||||||||||||||||||||    
30001782 tataaaattttaacttacacttgacacattaacatctc 30001819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 170 - 202
Target Start/End: Original strand, 43387145 - 43387177
Alignment:
170 aattttaactcacacttgacacattaacatctc 202  Q
    |||||||||||||||||||||||||||||||||    
43387145 aattttaactcacacttgacacattaacatctc 43387177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 173 - 202
Target Start/End: Complemental strand, 3982760 - 3982731
Alignment:
173 tttaactcacacttgacacattaacatctc 202  Q
    ||||||||||||||||||||||||||||||    
3982760 tttaactcacacttgacacattaacatctc 3982731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 173 - 201
Target Start/End: Complemental strand, 47783184 - 47783156
Alignment:
173 tttaactcacacttgacacattaacatct 201  Q
    |||||||||||||||||||||||||||||    
47783184 tttaactcacacttgacacattaacatct 47783156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0284 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: scaffold0284
Description:

Target: scaffold0284; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 1 - 285
Target Start/End: Original strand, 731 - 996
Alignment:
1 ttacactgagtattatcaccatattagactaagagataccatacaagtgagataaatatcacatattcacacaaaactttaagccagtagtatgtaaatg 100  Q
    ||||| ||||| |||||||||||||||||||||||||| |||| |||||| ||  |||||||||||||||||||||  ||||||||||| |||||| |||    
731 ttacattgagttttatcaccatattagactaagagatatcataaaagtgatattgatatcacatattcacacaaaatcttaagccagtaatatgtatatg 830  T
101 agtcatctcacttatatgttattcataatctactcttatatccataatttactcttatatccactataaaattttaactcacacttgacacattaacatc 200  Q
    ||||||||||||||||||||||||| |||||||                   |||| ||||||||||| || ||| ||||||||||||||||||||||||    
831 agtcatctcacttatatgttattcaaaatctac-------------------tcttctatccactatagaacttttactcacacttgacacattaacatc 911  T
201 tcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaa 285  Q
    || ||||||| ||||||||||||| ||| ||||||||| |||||||||| ||||||||||||| |||||||||||||||||||||    
912 tcttattcaaatttgcaactctctgtgtccataattacatgacatagtcaaataatatcaaatcaagacaccatatgtttaaaaa 996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 55; Significance: 1e-22; HSPs: 8)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 159 - 285
Target Start/End: Complemental strand, 21986315 - 21986190
Alignment:
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| |||||| |||||||||| ||||||||||| |||| ||| ||||||| |||||||||||| |||| ||||||||| ||| |||||| ||||| ||    
21986315 atccaatataaatttttaactcatacttgacacatcaacacctcttattcaaatttgcaactctc-ctgttcataattacatgatatagtcaaataagat 21986217  T
259 caaatgaagacaccatatgtttaaaaa 285  Q
    |||| ||||| ||  ||||||||||||    
21986216 caaaggaagatacagtatgtttaaaaa 21986190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 159 - 285
Target Start/End: Original strand, 33348201 - 33348326
Alignment:
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| ||||||  ||||||||| |||||||||||||| | ||| ||||||| ||||||||||||  ||| ||||||||||||| |||||| ||||| ||    
33348201 atccaatataaatatttaactcatacttgacacattaatacctcttattcaaatttgcaactctc-atgttcataattacgtgatatagtcaaataagat 33348299  T
259 caaatgaagacaccatatgtttaaaaa 285  Q
    | || ||||| || |||||||||||||    
33348300 cgaaggaagatacaatatgtttaaaaa 33348326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 202
Target Start/End: Original strand, 7428525 - 7428562
Alignment:
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
    ||||||||||||||||||||||||||||||||||||||    
7428525 tataaaattttaactcacacttgacacattaacatctc 7428562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 201
Target Start/End: Original strand, 16279120 - 16279156
Alignment:
165 tataaaattttaactcacacttgacacattaacatct 201  Q
    ||||||||||||||| |||||||||||||||||||||    
16279120 tataaaattttaacttacacttgacacattaacatct 16279156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 201
Target Start/End: Complemental strand, 28365771 - 28365735
Alignment:
165 tataaaattttaactcacacttgacacattaacatct 201  Q
    ||||||||||||||| |||||||||||||||||||||    
28365771 tataaaattttaacttacacttgacacattaacatct 28365735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 171 - 202
Target Start/End: Complemental strand, 1599722 - 1599691
Alignment:
171 attttaactcacacttgacacattaacatctc 202  Q
    ||||||||||||||||||||||||||||||||    
1599722 attttaactcacacttgacacattaacatctc 1599691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 175 - 220
Target Start/End: Original strand, 9449661 - 9449706
Alignment:
175 taactcacacttgacacattaacatctcctattcaagtttgcaact 220  Q
    ||||||||||||||||| |||||||||| || |||||| |||||||    
9449661 taactcacacttgacacgttaacatctcttaatcaagtgtgcaact 9449706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 16705671 - 16705606
Alignment:
147 atttactcttatatccactataaaattttaactcacacttgacacattaacatctcctattcaagt 212  Q
    ||||||||||| ||||| ||| ||| || |||||||  |||||||||||||||||  |||||||||    
16705671 atttactcttaaatccattatgaaacttcaactcacgtttgacacattaacatcttttattcaagt 16705606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1345 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold1345
Description:

Target: scaffold1345; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 202
Target Start/End: Complemental strand, 1894 - 1857
Alignment:
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
    ||||||||||||||||||||||||||||||||||||||    
1894 tataaaattttaactcacacttgacacattaacatctc 1857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 202
Target Start/End: Complemental strand, 43989728 - 43989691
Alignment:
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
    ||||||||||||||||||||||||||||||||||||||    
43989728 tataaaattttaactcacacttgacacattaacatctc 43989691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 92 - 132
Target Start/End: Complemental strand, 6198521 - 6198481
Alignment:
92 atgtaaatgagtcatctcacttatatgttattcataatcta 132  Q
    ||||| ||||||||| ||||||||||||||||||| |||||    
6198521 atgtatatgagtcatttcacttatatgttattcatcatcta 6198481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1750 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold1750
Description:

Target: scaffold1750; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 202
Target Start/End: Original strand, 324 - 361
Alignment:
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
    ||||||||||||||||||||||| ||||||||||||||    
324 tataaaattttaactcacacttgccacattaacatctc 361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 216877 times since January 2019
Visitors: 2908