View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_low_48 (Length: 302)

Name: NF0945_low_48
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0945_low_48
NF0945_low_48
[»] chr4 (13 HSPs)
chr4 (1-274)||(7723171-7723444)
chr4 (126-183)||(7130019-7130075)
chr4 (40-88)||(7493005-7493053)
chr4 (95-190)||(7519109-7519203)
chr4 (4-78)||(7716453-7716527)
chr4 (145-193)||(7493115-7493163)
chr4 (145-193)||(7502091-7502139)
chr4 (4-78)||(7522107-7522181)
chr4 (213-249)||(7493206-7493242)
chr4 (40-88)||(7501019-7501067)
chr4 (213-249)||(7502182-7502218)
chr4 (4-78)||(7484050-7484124)
chr4 (4-78)||(7720283-7720357)


Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 13)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 7723444 - 7723171
Alignment:
1 atttcaaagggttgttgtaatcagtttaacagtcttgaaaacttaaggattcaagattgttataatctaatttcaattgatggttatttgctaagcatta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7723444 atttcaaagggttgttgtaatcagtttaacagtcttgaaaacttaaggattcaagattgttataatctaatttcaattgatggttatttgctaagcatta 7723345  T
101 ttctaattccaattaacagtatatgctttttgcatagggtctcacatcttttgttagctcacttttgtattgaatttgtgacctcatgactcagtacnnn 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       
7723344 ttctaattccaattaacagtatatgctttttgcatagggtctcacatcttttgttagctcacttttgtattgaatttgtgacctcatgactcagtacttt 7723245  T
201 nnnnnagggatgtcatattctgcacatacattatctatccattattgctattgcttttgatagtgcttgctagt 274  Q
         |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7723244 tttttagggatgtcatattctgcacatacattatctatccattattgctattgcttttgatagtgcttgctagt 7723171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 126 - 183
Target Start/End: Complemental strand, 7130075 - 7130019
Alignment:
126 ctttttgcatagggtctcacatcttttgttagctcacttttgtattgaatttgtgacc 183  Q
    ||||||||||||| |||||||||||||||||||||||  |||||||||||||||||||    
7130075 ctttttgcatagg-tctcacatcttttgttagctcacccttgtattgaatttgtgacc 7130019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 40 - 88
Target Start/End: Original strand, 7493005 - 7493053
Alignment:
40 aacttaaggattcaagattgttataatctaatttcaattgatggttatt 88  Q
    |||||||||||||| |||||||| |||||||||||||||||||||||||    
7493005 aacttaaggattcatgattgttaaaatctaatttcaattgatggttatt 7493053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 95 - 190
Target Start/End: Original strand, 7519109 - 7519203
Alignment:
95 gcattattctaattccaattaacagtatatgctttttgcatagggtctcacatcttttgttagctcacttttgtattgaatttgtgacctcatgac 190  Q
    |||||||||||| |||| |||| |||| |||||||||||||| ||||||||||||| |||||| ||||  ||||  | ||||||||||| ||||||    
7519109 gcattattctaaatccatttaatagtaaatgctttttgcata-ggtctcacatcttatgttagttcaccattgttctaaatttgtgaccccatgac 7519203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 7716527 - 7716453
Alignment:
4 tcaaagggttgttgtaatcagtttaacagtcttgaaaacttaaggattcaagattgttataatctaatttcaatt 78  Q
    |||| ||| |||||| |||||||| | || |||||||||||| | ||||||||||||||||||||| ||||||||    
7716527 tcaaggggctgttgtcatcagtttgaaagacttgaaaacttatgtattcaagattgttataatctagtttcaatt 7716453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 145 - 193
Target Start/End: Original strand, 7493115 - 7493163
Alignment:
145 catcttttgttagctcacttttgtattgaatttgtgacctcatgactca 193  Q
    ||||||||||||| |||| |||||||||||||||||||| |||||||||    
7493115 catcttttgttagttcacctttgtattgaatttgtgaccgcatgactca 7493163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 145 - 193
Target Start/End: Original strand, 7502091 - 7502139
Alignment:
145 catcttttgttagctcacttttgtattgaatttgtgacctcatgactca 193  Q
    ||||||||||||| |||| |||||||||||||||||||| |||||||||    
7502091 catcttttgttagttcacctttgtattgaatttgtgaccccatgactca 7502139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 7522107 - 7522181
Alignment:
4 tcaaagggttgttgtaatcagtttaacagtcttgaaaacttaaggattcaagattgttataatctaatttcaatt 78  Q
    |||| |||||||||| |||||||| | |||||||||| ||||| |||| | ||||||||||| ||| ||||||||    
7522107 tcaaggggttgttgtcatcagtttcagagtcttgaaaccttaatgattaatgattgttataagctagtttcaatt 7522181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 213 - 249
Target Start/End: Original strand, 7493206 - 7493242
Alignment:
213 tcatattctgcacatacattatctatccattattgct 249  Q
    |||||||||||||||||| ||||||||||||||||||    
7493206 tcatattctgcacatacactatctatccattattgct 7493242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 40 - 88
Target Start/End: Original strand, 7501019 - 7501067
Alignment:
40 aacttaaggattcaagattgttataatctaatttcaattgatggttatt 88  Q
    |||||||||||||| |||| ||| |||||||||| ||||||||||||||    
7501019 aacttaaggattcatgattattaaaatctaatttaaattgatggttatt 7501067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 213 - 249
Target Start/End: Original strand, 7502182 - 7502218
Alignment:
213 tcatattctgcacatacattatctatccattattgct 249  Q
    |||||||||||||||||| ||||||||||||||||||    
7502182 tcatattctgcacatacactatctatccattattgct 7502218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 7484050 - 7484124
Alignment:
4 tcaaagggttgttgtaatcagtttaacagtcttgaaaacttaaggattcaagattgttataatctaatttcaatt 78  Q
    |||| |||||||||| |||||||| | |||||||||| ||||  |||| | ||||||||||| ||| ||||||||    
7484050 tcaaggggttgttgtcatcagtttcagagtcttgaaaccttattgattaatgattgttataagctagtttcaatt 7484124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 7720357 - 7720283
Alignment:
4 tcaaagggttgttgtaatcagtttaacagtcttgaaaacttaaggattcaagattgttataatctaatttcaatt 78  Q
    |||| |||||||||| ||||||||||||||||||||| |||| | |||   | ||||| ||||||| ||||||||    
7720357 tcaaggggttgttgtcatcagtttaacagtcttgaaagcttatgtatttctgtttgttgtaatctagtttcaatt 7720283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 37926 times since January 2019
Visitors: 1598