View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_low_49 (Length: 301)

Name: NF0945_low_49
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0945_low_49
[»] chr4 (13 HSPs)
chr4 (1-273)||(7723171-7723444)
chr4 (126-183)||(7130019-7130075)
chr4 (40-88)||(7493005-7493053)
chr4 (95-190)||(7519109-7519203)
chr4 (4-78)||(7716453-7716527)
chr4 (145-193)||(7493115-7493163)
chr4 (145-193)||(7502091-7502139)
chr4 (4-78)||(7522107-7522181)
chr4 (212-248)||(7493206-7493242)
chr4 (40-88)||(7501019-7501067)
chr4 (212-248)||(7502182-7502218)
chr4 (4-78)||(7484050-7484124)
chr4 (4-78)||(7720283-7720357)

Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 13)
Name: chr4

Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 7723444 - 7723171
1 atttcaaagggttgttgtaatcagtttaacagtcttgaaaacttaaggattcaagattgttataatctaatttcaattgatggttatttgctaagcatta 100  Q
7723444 atttcaaagggttgttgtaatcagtttaacagtcttgaaaacttaaggattcaagattgttataatctaatttcaattgatggttatttgctaagcatta 7723345  T
101 ttctaattccaattaacagtatatgctttttgcatagggtctcacatcttttgttagctcacttttgtattgaatttgtgacctcatgactcagtac-nn 199  Q
7723344 ttctaattccaattaacagtatatgctttttgcatagggtctcacatcttttgttagctcacttttgtattgaatttgtgacctcatgactcagtacttt 7723245  T
200 nnnnnagggatgtcatattctgcacatacattatctatccattattgctattgcttttgatagtgcttgctagt 273  Q
7723244 tttttagggatgtcatattctgcacatacattatctatccattattgctattgcttttgatagtgcttgctagt 7723171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 126 - 183
Target Start/End: Complemental strand, 7130075 - 7130019
126 ctttttgcatagggtctcacatcttttgttagctcacttttgtattgaatttgtgacc 183  Q
    ||||||||||||| |||||||||||||||||||||||  |||||||||||||||||||    
7130075 ctttttgcatagg-tctcacatcttttgttagctcacccttgtattgaatttgtgacc 7130019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 40 - 88
Target Start/End: Original strand, 7493005 - 7493053
40 aacttaaggattcaagattgttataatctaatttcaattgatggttatt 88  Q
    |||||||||||||| |||||||| |||||||||||||||||||||||||    
7493005 aacttaaggattcatgattgttaaaatctaatttcaattgatggttatt 7493053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 95 - 190
Target Start/End: Original strand, 7519109 - 7519203
95 gcattattctaattccaattaacagtatatgctttttgcatagggtctcacatcttttgttagctcacttttgtattgaatttgtgacctcatgac 190  Q
    |||||||||||| |||| |||| |||| |||||||||||||| ||||||||||||| |||||| ||||  ||||  | ||||||||||| ||||||    
7519109 gcattattctaaatccatttaatagtaaatgctttttgcata-ggtctcacatcttatgttagttcaccattgttctaaatttgtgaccccatgac 7519203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 7716527 - 7716453
4 tcaaagggttgttgtaatcagtttaacagtcttgaaaacttaaggattcaagattgttataatctaatttcaatt 78  Q
    |||| ||| |||||| |||||||| | || |||||||||||| | ||||||||||||||||||||| ||||||||    
7716527 tcaaggggctgttgtcatcagtttgaaagacttgaaaacttatgtattcaagattgttataatctagtttcaatt 7716453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 145 - 193
Target Start/End: Original strand, 7493115 - 7493163
145 catcttttgttagctcacttttgtattgaatttgtgacctcatgactca 193  Q
    ||||||||||||| |||| |||||||||||||||||||| |||||||||    
7493115 catcttttgttagttcacctttgtattgaatttgtgaccgcatgactca 7493163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 145 - 193
Target Start/End: Original strand, 7502091 - 7502139
145 catcttttgttagctcacttttgtattgaatttgtgacctcatgactca 193  Q
    ||||||||||||| |||| |||||||||||||||||||| |||||||||    
7502091 catcttttgttagttcacctttgtattgaatttgtgaccccatgactca 7502139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 7522107 - 7522181
4 tcaaagggttgttgtaatcagtttaacagtcttgaaaacttaaggattcaagattgttataatctaatttcaatt 78  Q
    |||| |||||||||| |||||||| | |||||||||| ||||| |||| | ||||||||||| ||| ||||||||    
7522107 tcaaggggttgttgtcatcagtttcagagtcttgaaaccttaatgattaatgattgttataagctagtttcaatt 7522181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 212 - 248
Target Start/End: Original strand, 7493206 - 7493242
212 tcatattctgcacatacattatctatccattattgct 248  Q
    |||||||||||||||||| ||||||||||||||||||    
7493206 tcatattctgcacatacactatctatccattattgct 7493242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 40 - 88
Target Start/End: Original strand, 7501019 - 7501067
40 aacttaaggattcaagattgttataatctaatttcaattgatggttatt 88  Q
    |||||||||||||| |||| ||| |||||||||| ||||||||||||||    
7501019 aacttaaggattcatgattattaaaatctaatttaaattgatggttatt 7501067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 212 - 248
Target Start/End: Original strand, 7502182 - 7502218
212 tcatattctgcacatacattatctatccattattgct 248  Q
    |||||||||||||||||| ||||||||||||||||||    
7502182 tcatattctgcacatacactatctatccattattgct 7502218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 7484050 - 7484124
4 tcaaagggttgttgtaatcagtttaacagtcttgaaaacttaaggattcaagattgttataatctaatttcaatt 78  Q
    |||| |||||||||| |||||||| | |||||||||| ||||  |||| | ||||||||||| ||| ||||||||    
7484050 tcaaggggttgttgtcatcagtttcagagtcttgaaaccttattgattaatgattgttataagctagtttcaatt 7484124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 7720357 - 7720283
4 tcaaagggttgttgtaatcagtttaacagtcttgaaaacttaaggattcaagattgttataatctaatttcaatt 78  Q
    |||| |||||||||| ||||||||||||||||||||| |||| | |||   | ||||| ||||||| ||||||||    
7720357 tcaaggggttgttgtcatcagtttaacagtcttgaaagcttatgtatttctgtttgttgtaatctagtttcaatt 7720283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 111524 times since January 2019
Visitors: 1375