View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_low_5 (Length: 706)

Name: NF0945_low_5
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0945_low_5
NF0945_low_5
[»] chr4 (3 HSPs)
chr4 (3-635)||(24295176-24295819)
chr4 (9-87)||(24508608-24508686)
chr4 (3-142)||(24510956-24511092)


Alignment Details
Target: chr4 (Bit Score: 528; Significance: 0; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 528; E-Value: 0
Query Start/End: Original strand, 3 - 635
Target Start/End: Complemental strand, 24295819 - 24295176
Alignment:
3 gctcttatgtctttcaatggtggtgtgtttttggttgctgtgcttggtcatgctcttggattcttcttatgtagcagtgcttttaggaaaccaaaacaac 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24295819 gctcttatgtctttcaatggtggtgtgtttttggttgctgtgcttggtcatgctcttggattcttcttatgtagcagtgcttttaggaaaccaaaacaac 24295720  T
103 atgatgaggcttatgatcttcctccgttgtcttgttaattgtttct---------taaatttataccttttgtttcctctgttagttaattataaattaa 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||| |||||||||||||||||||||    
24295719 atgatgaggcttatgatcttcctccgttgtcttgttaattgtttctactgtttcttaaatttataccttttgtttcctttgttagttaattataaattaa 24295620  T
194 taataattacaaaagtgctactattttgcagttattgtcttgggtatcaaattttgt-atgaaattgcagttggtttaaaatatagatttctttttgaat 292  Q
    ||||||| |||||| | |||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||     
24295619 taataatcacaaaactactactattttgcagttattgtcttgggtatcaaactttgttatgaaattgcagttggtttaaaatatagatttctttttgaag 24295520  T
293 taaaatttgtggtgaggttagttgcgtggcccgcaggctcatttagggttagtatatgagagttgaacctacgtc-ttgcaggtaaaagtcaatttctta 391  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||||||||||||||||||    
24295519 taaaatttgaggtgaggttagttgcgtggcccgcaggctcatttagggttagtatacgagagttgaacctacgtccttgccggtaaaagtcaatttctta 24295420  T
392 ctaattggtttgcattttgttgataatttgtaaatttgtaattgtctccgtgcgatttatgtcaatctagtataatataaaaacttatgcaaaaatgact 491  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |    
24295419 ctaattggtttgcgttttgttgataatttgtaaatttgtaattgtctccgtgcgatttatgtcaatcttgtgtaatataaaaacttatgcaaaaatgatt 24295320  T
492 atttcagtttggcactagagaaaacaatggttctctaatgccttgcataaggagcatgtgtgagataatgactctttggaccccgtagttagactacaaa 591  Q
    |||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
24295319 atttgagtttggcactagagaaaacaatggttttctaatgccttgcataaggagcatgtgtgagataatgaccctttggaccccgtagttagactacaaa 24295220  T
592 ctttgggtattgcattttttgtttactcacctttggatattatt 635  Q
    |||||||||||| |||||||||||||||||||||||||||||||    
24295219 ctttgggtattgtattttttgtttactcacctttggatattatt 24295176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 9 - 87
Target Start/End: Complemental strand, 24508686 - 24508608
Alignment:
9 atgtctttcaatggtggtgtgtttttggttgctgtgcttggtcatgctcttggattcttcttatgtagcagtgctttta 87  Q
    ||||||||||||||||| ||||| ||||||| ||| |||||||||||||||||||||||| |||||||| |||||||||    
24508686 atgtctttcaatggtggagtgttcttggttgttgtacttggtcatgctcttggattcttcgtatgtagccgtgctttta 24508608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 3 - 142
Target Start/End: Complemental strand, 24511092 - 24510956
Alignment:
3 gctcttatgtctttcaatggtggtgtgtttttggttgctgtgcttggtcatgctcttggattcttcttatgtagcagtgcttttaggaaaccaaaacaac 102  Q
    ||||| ||||||||||||||||| ||||| |||||||||||||||||||||||| |||| ||||||||  ||||| ||||||| |  |||||   ||| |    
24511092 gctctcatgtctttcaatggtggagtgttcttggttgctgtgcttggtcatgctgttgggttcttctttcgtagccgtgctttcaaaaaacc---acatc 24510996  T
103 atgatgaggcttatgatcttcctccgttgtcttgttaatt 142  Q
    | ||||||  ||  |||||||||||||| |||||||||||    
24510995 aagatgagaatttcgatcttcctccgttatcttgttaatt 24510956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 211503 times since January 2019
Visitors: 2901