View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_low_5 (Length: 706)

Name: NF0945_low_5
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0945_low_5
[»] chr4 (3 HSPs)
chr4 (3-635)||(24295176-24295819)
chr4 (9-87)||(24508608-24508686)
chr4 (3-142)||(24510956-24511092)

Alignment Details
Target: chr4 (Bit Score: 528; Significance: 0; HSPs: 3)
Name: chr4

Target: chr4; HSP #1
Raw Score: 528; E-Value: 0
Query Start/End: Original strand, 3 - 635
Target Start/End: Complemental strand, 24295819 - 24295176
3 gctcttatgtctttcaatggtggtgtgtttttggttgctgtgcttggtcatgctcttggattcttcttatgtagcagtgcttttaggaaaccaaaacaac 102  Q
24295819 gctcttatgtctttcaatggtggtgtgtttttggttgctgtgcttggtcatgctcttggattcttcttatgtagcagtgcttttaggaaaccaaaacaac 24295720  T
103 atgatgaggcttatgatcttcctccgttgtcttgttaattgtttct---------taaatttataccttttgtttcctctgttagttaattataaattaa 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||| |||||||||||||||||||||    
24295719 atgatgaggcttatgatcttcctccgttgtcttgttaattgtttctactgtttcttaaatttataccttttgtttcctttgttagttaattataaattaa 24295620  T
194 taataattacaaaagtgctactattttgcagttattgtcttgggtatcaaattttgt-atgaaattgcagttggtttaaaatatagatttctttttgaat 292  Q
    ||||||| |||||| | |||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||     
24295619 taataatcacaaaactactactattttgcagttattgtcttgggtatcaaactttgttatgaaattgcagttggtttaaaatatagatttctttttgaag 24295520  T
293 taaaatttgtggtgaggttagttgcgtggcccgcaggctcatttagggttagtatatgagagttgaacctacgtc-ttgcaggtaaaagtcaatttctta 391  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||||||||||||||||||    
24295519 taaaatttgaggtgaggttagttgcgtggcccgcaggctcatttagggttagtatacgagagttgaacctacgtccttgccggtaaaagtcaatttctta 24295420  T
392 ctaattggtttgcattttgttgataatttgtaaatttgtaattgtctccgtgcgatttatgtcaatctagtataatataaaaacttatgcaaaaatgact 491  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |    
24295419 ctaattggtttgcgttttgttgataatttgtaaatttgtaattgtctccgtgcgatttatgtcaatcttgtgtaatataaaaacttatgcaaaaatgatt 24295320  T
492 atttcagtttggcactagagaaaacaatggttctctaatgccttgcataaggagcatgtgtgagataatgactctttggaccccgtagttagactacaaa 591  Q
    |||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
24295319 atttgagtttggcactagagaaaacaatggttttctaatgccttgcataaggagcatgtgtgagataatgaccctttggaccccgtagttagactacaaa 24295220  T
592 ctttgggtattgcattttttgtttactcacctttggatattatt 635  Q
    |||||||||||| |||||||||||||||||||||||||||||||    
24295219 ctttgggtattgtattttttgtttactcacctttggatattatt 24295176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 9 - 87
Target Start/End: Complemental strand, 24508686 - 24508608
9 atgtctttcaatggtggtgtgtttttggttgctgtgcttggtcatgctcttggattcttcttatgtagcagtgctttta 87  Q
    ||||||||||||||||| ||||| ||||||| ||| |||||||||||||||||||||||| |||||||| |||||||||    
24508686 atgtctttcaatggtggagtgttcttggttgttgtacttggtcatgctcttggattcttcgtatgtagccgtgctttta 24508608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 3 - 142
Target Start/End: Complemental strand, 24511092 - 24510956
3 gctcttatgtctttcaatggtggtgtgtttttggttgctgtgcttggtcatgctcttggattcttcttatgtagcagtgcttttaggaaaccaaaacaac 102  Q
    ||||| ||||||||||||||||| ||||| |||||||||||||||||||||||| |||| ||||||||  ||||| ||||||| |  |||||   ||| |    
24511092 gctctcatgtctttcaatggtggagtgttcttggttgctgtgcttggtcatgctgttgggttcttctttcgtagccgtgctttcaaaaaacc---acatc 24510996  T
103 atgatgaggcttatgatcttcctccgttgtcttgttaatt 142  Q
    | ||||||  ||  |||||||||||||| |||||||||||    
24510995 aagatgagaatttcgatcttcctccgttatcttgttaatt 24510956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 125335 times since January 2019
Visitors: 1457