View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_low_63 (Length: 257)

Name: NF0945_low_63
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0945_low_63
NF0945_low_63
[»] chr2 (5 HSPs)
chr2 (4-237)||(24543091-24543324)
chr2 (4-237)||(29894321-29894554)
chr2 (4-237)||(36364918-36365151)
chr2 (130-237)||(40287017-40287124)
chr2 (130-181)||(12555415-12555466)
[»] chr1 (18 HSPs)
chr1 (4-237)||(11351597-11351830)
chr1 (7-237)||(6784159-6784389)
chr1 (22-237)||(21515101-21515314)
chr1 (4-201)||(20639468-20639665)
chr1 (4-237)||(32988886-32989121)
chr1 (130-230)||(2536489-2536589)
chr1 (130-237)||(44839857-44839964)
chr1 (130-208)||(51080701-51080779)
chr1 (132-218)||(39648376-39648462)
chr1 (131-193)||(2114361-2114423)
chr1 (131-193)||(3601265-3601327)
chr1 (131-193)||(17321880-17321942)
chr1 (137-194)||(26418788-26418845)
chr1 (137-194)||(32108435-32108492)
chr1 (131-193)||(12539121-12539183)
chr1 (171-237)||(52823473-52823539)
chr1 (139-194)||(5811388-5811443)
chr1 (137-185)||(4179980-4180028)
[»] chr8 (5 HSPs)
chr8 (4-237)||(18481111-18481344)
chr8 (6-207)||(32536156-32536357)
chr8 (130-237)||(26440810-26440917)
chr8 (130-237)||(7251110-7251217)
chr8 (130-219)||(11911382-11911471)
[»] chr3 (18 HSPs)
chr3 (4-237)||(36684783-36685016)
chr3 (4-237)||(51976638-51976871)
chr3 (8-237)||(8705594-8705823)
chr3 (8-237)||(9057481-9057710)
chr3 (16-237)||(45736356-45736577)
chr3 (4-234)||(4978417-4978648)
chr3 (53-199)||(49758956-49759102)
chr3 (130-237)||(47165345-47165452)
chr3 (130-207)||(38998911-38998988)
chr3 (130-237)||(37796609-37796716)
chr3 (8-164)||(26390800-26390956)
chr3 (104-182)||(20916387-20916465)
chr3 (104-182)||(20925349-20925427)
chr3 (137-194)||(32073607-32073664)
chr3 (131-193)||(10346527-10346589)
chr3 (131-193)||(1017670-1017732)
chr3 (130-184)||(25131086-25131140)
chr3 (131-220)||(29237227-29237316)
[»] chr4 (15 HSPs)
chr4 (4-237)||(43989258-43989490)
chr4 (56-237)||(19315890-19316071)
chr4 (141-237)||(43813171-43813267)
chr4 (130-232)||(1394129-1394232)
chr4 (131-179)||(9633063-9633111)
chr4 (131-193)||(35096913-35096975)
chr4 (137-194)||(13200849-13200906)
chr4 (137-194)||(47783000-47783057)
chr4 (131-183)||(1479285-1479337)
chr4 (131-193)||(6969614-6969676)
chr4 (131-177)||(17283581-17283627)
chr4 (129-174)||(5124643-5124688)
chr4 (157-237)||(36469295-36469374)
chr4 (131-193)||(16889147-16889209)
chr4 (131-193)||(37857014-37857076)
[»] chr6 (9 HSPs)
chr6 (4-237)||(942571-942804)
chr6 (130-237)||(4513076-4513183)
chr6 (131-217)||(19047092-19047178)
chr6 (137-194)||(15950809-15950866)
chr6 (130-237)||(12125820-12125927)
chr6 (131-235)||(13757503-13757607)
chr6 (155-237)||(20731689-20731771)
chr6 (137-194)||(21698719-21698776)
chr6 (137-194)||(30063666-30063723)
[»] chr5 (12 HSPs)
chr5 (43-237)||(41197356-41197550)
chr5 (15-237)||(36779403-36779622)
chr5 (114-237)||(30376427-30376550)
chr5 (130-237)||(12714847-12714954)
chr5 (130-237)||(12776078-12776185)
chr5 (185-237)||(12378608-12378660)
chr5 (80-236)||(34905529-34905685)
chr5 (130-183)||(34525-34578)
chr5 (131-207)||(14856952-14857028)
chr5 (133-228)||(29985435-29985530)
chr5 (137-194)||(19609156-19609213)
chr5 (176-237)||(39714874-39714935)
[»] chr7 (12 HSPs)
chr7 (4-237)||(23820401-23820634)
chr7 (8-237)||(24808771-24808980)
chr7 (130-237)||(21118399-21118505)
chr7 (134-239)||(40901803-40901908)
chr7 (131-183)||(12980735-12980787)
chr7 (135-193)||(20492489-20492547)
chr7 (137-194)||(29526837-29526894)
chr7 (137-193)||(10325110-10325166)
chr7 (130-180)||(31957050-31957100)
chr7 (137-194)||(664990-665047)
chr7 (137-194)||(21588151-21588208)
chr7 (131-191)||(8321192-8321252)
[»] scaffold0041 (1 HSPs)
scaffold0041 (134-239)||(48110-48215)


Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 4 - 237
Target Start/End: Original strand, 24543091 - 24543324
Alignment:
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 103  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
24543091 tcattatgacaatgttgattttgttttggattgcaagtctgttgttgaacattttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 24543190  T
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccc 203  Q
    ||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||    
24543191 gcttgtagatagttgttcgattgtaattttcagaactctcatgtcgagttcaataggatgcaagccaatggggtcgctcatgaattagctagggtagccc 24543290  T
204 catctcatgctagctcccacgtttatgatgatgt 237  Q
    ||||||||||||||||||||||||||||||||||    
24543291 catctcatgctagctcccacgtttatgatgatgt 24543324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 4 - 237
Target Start/End: Complemental strand, 29894554 - 29894321
Alignment:
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 103  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||    
29894554 tcattatgacaatgttgattttgttttggattgcaagtctgttgttgaacattttaattcaaacctaggtgatagcagtgaactagattgtattattcag 29894455  T
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccc 203  Q
    ||||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
29894454 gcttgtagacagttgttcgattgtaattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtagccc 29894355  T
204 catctcatgctagctcccacgtttatgatgatgt 237  Q
    ||||||||||||||||||||||||||||||||||    
29894354 catctcatgctagctcccacgtttatgatgatgt 29894321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 4 - 237
Target Start/End: Original strand, 36364918 - 36365151
Alignment:
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 103  Q
    |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
36364918 tcattatgacaatgttgattttgttttggattccaagtctgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcat 36365017  T
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccc 203  Q
     ||||||   |||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||    
36365018 acttgtaggcagttgttcgattgtcattttcagaactcccatgtcgagttcaataggaggcaagccaatgaggtcgctcatgaattagctagggtagccc 36365117  T
204 catctcatgctagctcccacgtttatgatgatgt 237  Q
    ||||||||||||||||||||||||||| ||||||    
36365118 catctcatgctagctcccacgtttatggtgatgt 36365151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 130 - 237
Target Start/End: Complemental strand, 40287124 - 40287017
Alignment:
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttat 229  Q
    |||||| |||||||||||| |||| |||| ||||||||| ||||||||| ||||||||||||| |||||| |||||||| || ||||| ||  | |||||    
40287124 ttttcaaaactctcatgtcaagtttaatatgaggcaagctaatggggtcactcatgaattagcgagggtagccccatctgatcctagccccaccatttat 40287025  T
230 gatgatgt 237  Q
    ||||||||    
40287024 gatgatgt 40287017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 130 - 181
Target Start/End: Complemental strand, 12555466 - 12555415
Alignment:
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgct 181  Q
    ||||||||||||||||||| ||||||||||||||||||  ||||||||||||    
12555466 ttttcagaactctcatgtcaagttcaataggaggcaagttaatggggtcgct 12555415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 18)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 4 - 237
Target Start/End: Complemental strand, 11351830 - 11351597
Alignment:
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 103  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
11351830 tcattatgacaatgttgattttgttttggattgcaagtctgttgttgaacattttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 11351731  T
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccc 203  Q
    ||||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
11351730 gcttgtagacagttgttcgattgtaattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtagccc 11351631  T
204 catctcatgctagctcccacgtttatgatgatgt 237  Q
    ||||||||||||||| ||||||||||||||||||    
11351630 catctcatgctagcttccacgtttatgatgatgt 11351597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 7 - 237
Target Start/End: Original strand, 6784159 - 6784389
Alignment:
7 ttatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcaggct 106  Q
    ||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
6784159 ttatgacaatgttgattttgttttggattgcaagtctcttgttgaacgttttaatttaaacctaggtgatagcagtgaactaggttgtattattcaggct 6784258  T
107 tgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccat 206  Q
    |||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| | ||||    
6784259 tgtagacagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgcttatgaattaactagggtagctccat 6784358  T
207 ctcatgctagctcccacgtttatgatgatgt 237  Q
    ||||| |||||| ||||||||||||| ||||    
6784359 ctcatactagcttccacgtttatgataatgt 6784389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 22 - 237
Target Start/End: Original strand, 21515101 - 21515314
Alignment:
22 ttttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcaggcttgtaaatagttgttc 121  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||   ||||||||    
21515101 ttttgttttggattgcaagtctgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtatttttcaggtttgtaggcagttgttc 21515200  T
122 gattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctccc 221  Q
    || ||| |||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
21515201 gaatgtaattttcagaactc--atgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtagccccatctcatgctagctccc 21515298  T
222 acgtttatgatgatgt 237  Q
    ||||||||||||||||    
21515299 acgtttatgatgatgt 21515314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 4 - 201
Target Start/End: Original strand, 20639468 - 20639665
Alignment:
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 103  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||    
20639468 tcattatgacaatgttgattttgttttggattccaagtttgttgttgaacattttaattcaaacctaggtgatagtagtgaactaggttgtattattcag 20639567  T
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaac 201  Q
    |||||||   |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |||| |||||||||||||||| |||||    
20639568 gcttgtaggcagttgttcgattgtaattttcagaactctcatgttgagttcaataggaggcaagccaatgaggtcactcatgaattagctagtgtaac 20639665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 4 - 237
Target Start/End: Complemental strand, 32989121 - 32988886
Alignment:
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 103  Q
    |||||||||| |||| |||||||||| ||||| ||||| |||||||||||||||||||| |||| || ||||||||||||||||||||||||||||||||    
32989121 tcattatgacgatgtggattttgtttcggattccaagtatgttgttgaacgttttaatttaaacttacgtgatagcagtgaactaggttgtattattcag 32989022  T
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagt----tcaataggaggcaagccaatggggtcgctcatgaattagctagggta 199  Q
     ||||||   |||||||||||||| | ||||||||||||||||||||||    |  |||||||||||||||||    ||||||||||||||| |||||||    
32989021 acttgtaggcagttgttcgattgtaactttcagaactctcatgtcgagttatatatataggaggcaagccaat--tttcgctcatgaattagttagggta 32988924  T
200 accccatctcatgctagctcccacgtttatgatgatgt 237  Q
     |||||||||||||||||| || |||||||||||||||    
32988923 gccccatctcatgctagcttccgcgtttatgatgatgt 32988886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 130 - 230
Target Start/End: Complemental strand, 2536589 - 2536489
Alignment:
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttat 229  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| ||||||    
2536589 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagttagggtagccccatctcatgctagctcccatgtttat 2536490  T
230 g 230  Q
    |    
2536489 g 2536489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 130 - 237
Target Start/End: Complemental strand, 44839964 - 44839857
Alignment:
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttat 229  Q
    ||||||||||||||||||||||||||||||||||||||  ||||||||||||||||| |||||||||||| |||||||| ||||||||||| ||||||||    
44839964 ttttcagaactctcatgtcgagttcaataggaggcaagttaatggggtcgctcatgagttagctagggtagccccatctaatgctagctcctacgtttat 44839865  T
230 gatgatgt 237  Q
    ||| ||||    
44839864 gataatgt 44839857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 130 - 208
Target Start/End: Complemental strand, 51080779 - 51080701
Alignment:
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatct 208  Q
    |||||| ||||||||||||||||| |||||||||||| | ||||||||||||||||||||||| |||||| ||||||||    
51080779 ttttcaaaactctcatgtcgagtttaataggaggcaatctaatggggtcgctcatgaattagcgagggtagccccatct 51080701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 132 - 218
Target Start/End: Complemental strand, 39648462 - 39648376
Alignment:
132 ttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagct 218  Q
    |||||||||||| ||||||||| ||||| || ||||| |||  |||||||||||||||||||  |||| ||||||||||||||||||    
39648462 ttcagaactctcgtgtcgagtttaatagaagtcaagctaattaggtcgctcatgaattagctcaggtagccccatctcatgctagct 39648376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 131 - 193
Target Start/End: Original strand, 2114361 - 2114423
Alignment:
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagct 193  Q
    |||||||||||||||||||||||||| |||| | |||| |||||||||||||| |||||||||    
2114361 tttcagaactctcatgtcgagttcaacaggaaggaagcgaatggggtcgctcacgaattagct 2114423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 131 - 193
Target Start/End: Complemental strand, 3601327 - 3601265
Alignment:
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagct 193  Q
    |||||||||||||||||||||||||||||||||||||| |||| ||| ||||| || ||||||    
3601327 tttcagaactctcatgtcgagttcaataggaggcaagcgaatgaggttgctcacgagttagct 3601265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 131 - 193
Target Start/End: Original strand, 17321880 - 17321942
Alignment:
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagct 193  Q
    |||||||||||||||||||||||||| ||||||||||| ||| |||| ||||| || ||||||    
17321880 tttcagaactctcatgtcgagttcaacaggaggcaagcaaatagggtagctcacgagttagct 17321942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 194
Target Start/End: Complemental strand, 26418845 - 26418788
Alignment:
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||||| | |||||||||||| |||| ||| ||||||||||||||||    
26418845 aactctcatgtcgagtttactaggaggcaagcaaatgaggttgctcatgaattagcta 26418788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 194
Target Start/End: Original strand, 32108435 - 32108492
Alignment:
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||||| | |||||||||||| |||| ||| ||||||||||||||||    
32108435 aactctcatgtcgagtttactaggaggcaagcaaatgaggttgctcatgaattagcta 32108492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 131 - 193
Target Start/End: Original strand, 12539121 - 12539183
Alignment:
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagct 193  Q
    |||||||||||||||||||||||||| ||||||||||| ||| || | ||||| || ||||||    
12539121 tttcagaactctcatgtcgagttcaacaggaggcaagcaaataggatagctcacgagttagct 12539183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 171 - 237
Target Start/End: Complemental strand, 52823539 - 52823473
Alignment:
171 atggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttatgatgatgt 237  Q
    ||||||||||||||||||||| ||||||| | ||||||||| ||| |||| | ||||| ||||||||    
52823539 atggggtcgctcatgaattagttagggtagctccatctcatactaactcctatgtttacgatgatgt 52823473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 139 - 194
Target Start/End: Original strand, 5811388 - 5811443
Alignment:
139 ctctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||| |||||||| ||| | |||||||| |||||| |||||||||    
5811388 ctctcatgtcgagtttaataggagacaaacaaatggggtagctcattaattagcta 5811443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 137 - 185
Target Start/End: Original strand, 4179980 - 4180028
Alignment:
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatg 185  Q
    ||||||||||||||||| | |||||||||||| |||| ||| |||||||    
4179980 aactctcatgtcgagtttattaggaggcaagcaaatgaggttgctcatg 4180028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 4 - 237
Target Start/End: Original strand, 18481111 - 18481344
Alignment:
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 103  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
18481111 tcattatgacaatgttgattttgttttggattgcaagtctgttgttgaacattttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 18481210  T
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccc 203  Q
    ||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |||||||||| ||||| |||||||||||||| |||    
18481211 gcttgtagatagttgttcgattgtaattttcagaactctcatgtcgagttcaataggaggtaagtcaatggggtcactcataaattagctagggtagccc 18481310  T
204 catctcatgctagctcccacgtttatgatgatgt 237  Q
    ||||||||||||||||||||||||||||||||||    
18481311 catctcatgctagctcccacgtttatgatgatgt 18481344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 6 - 207
Target Start/End: Complemental strand, 32536357 - 32536156
Alignment:
6 attatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcaggc 105  Q
    |||||||  |||| ||||||| |||||||| ||||||| |||| || || ||| ||||||||||||  ||||  ||||||||||||||||||||||||||    
32536357 attatgatcatgtcgattttgctttggattacaagtttattgtagatcgctttcattcaaacctagacgataatagtgaactaggttgtattattcaggc 32536258  T
106 ttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaacccca 205  Q
    ||||||| | ||| | | |||| |||||  ||||||| |||||||||||||| | |  ||||  ||||||||||||| |||||||||||||||| |||||    
32536257 ttgtaaacaattgattgcttgtaattttatgaactcttatgtcgagttcaattgaaaacaagttaatggggtcgctcgtgaattagctagggtagcccca 32536158  T
206 tc 207  Q
    ||    
32536157 tc 32536156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 130 - 237
Target Start/End: Original strand, 26440810 - 26440917
Alignment:
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttat 229  Q
    |||| |||||||||||||||||||||||||||||||||| |||||||| |||||||| |||||||||||| |||||||| |||||||||| |||| ||||    
26440810 tttttagaactctcatgtcgagttcaataggaggcaagctaatggggttgctcatgagttagctagggtagccccatctaatgctagctctcacgattat 26440909  T
230 gatgatgt 237  Q
    ||| ||||    
26440910 gataatgt 26440917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 130 - 237
Target Start/End: Original strand, 7251110 - 7251217
Alignment:
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttat 229  Q
    ||||||||||||| ||||||||||||||||||||||| |||||||| || |||||| |||| ||| |||| |||||||||||||||||| ||| | ||||    
7251110 ttttcagaactcttatgtcgagttcaataggaggcaaaccaatgggatcactcatgcattaactaaggtagccccatctcatgctagcttccatgattat 7251209  T
230 gatgatgt 237  Q
    ||| ||||    
7251210 gataatgt 7251217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 130 - 219
Target Start/End: Complemental strand, 11911471 - 11911382
Alignment:
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctc 219  Q
    |||||| ||||||||||||||||||||||||||| || | ||||||||| | || || |||||| ||| | |||||| | || |||||||    
11911471 ttttcaaaactctcatgtcgagttcaataggaggtaaacgaatggggtcccccacgagttagctcgggaagccccatttaatcctagctc 11911382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 18)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 4 - 237
Target Start/End: Original strand, 36684783 - 36685016
Alignment:
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 103  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||||    
36684783 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacattttaattcaaacctaggtgatagtagtgaactaggttgtatcattcag 36684882  T
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccc 203  Q
    ||||||| | |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||    
36684883 gcttgtagacagttgttcgattgtaattttcagaactctcatgtcgagttcaataggaggcaagctaatggggtcgctcatgaattagctagggtagccc 36684982  T
204 catctcatgctagctcccacgtttatgatgatgt 237  Q
    |||||||||||||||| |||||||||||||||||    
36684983 catctcatgctagctctcacgtttatgatgatgt 36685016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 4 - 237
Target Start/End: Original strand, 51976638 - 51976871
Alignment:
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 103  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
51976638 tcattatgacaatgttgattttgttttggattgcaagtctgttgttgaacattttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 51976737  T
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccc 203  Q
    ||||||| | ||||||| |||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | |    
51976738 gcttgtagaaagttgtttgattgtaattttcagaactctcatgccgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtagctc 51976837  T
204 catctcatgctagctcccacgtttatgatgatgt 237  Q
    ||||||||||||||||||||||||||||||||||    
51976838 catctcatgctagctcccacgtttatgatgatgt 51976871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 8 - 237
Target Start/End: Original strand, 8705594 - 8705823
Alignment:
8 tatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcaggctt 107  Q
    |||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||    
8705594 tatgaccatgttgattttgttttggattccaagtatgttgttgaacgttttaattcaaacctagttgatagtagtgaactaggttgtattattcaggctt 8705693  T
108 gtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatc 207  Q
    |||   ||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |||| ||||||| ||||||||| ||||||| |||||||    
8705694 gtaggcagttgtttgattgtaattttcagaactctcatgtcgagttcaataggaggcaagctaatgaggtcgcttatgaattagttagggtagccccatc 8705793  T
208 tcatgctagctcccacgtttatgatgatgt 237  Q
    |||| |||||||||||||||||||||||||    
8705794 tcatactagctcccacgtttatgatgatgt 8705823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 8 - 237
Target Start/End: Original strand, 9057481 - 9057710
Alignment:
8 tatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcaggctt 107  Q
    |||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||    
9057481 tatgaccatgttgattttgttttggattccaagtatgttgttgaacgttttaattcaaacctagttgatagtagtgaactaggttgtattattcaggctt 9057580  T
108 gtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatc 207  Q
    |||   ||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |||| ||||||| ||||||||| ||||||| |||||||    
9057581 gtaggcagttgtttgattgtaattttcagaactctcatgtcgagttcaataggaggcaagctaatgaggtcgcttatgaattagttagggtagccccatc 9057680  T
208 tcatgctagctcccacgtttatgatgatgt 237  Q
    |||| |||||||||||||||||||||||||    
9057681 tcatactagctcccacgtttatgatgatgt 9057710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 16 - 237
Target Start/End: Original strand, 45736356 - 45736577
Alignment:
16 tgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcaggcttgtaaatag 115  Q
    |||||||||||||||||||| ||||||||||||| |||||||||||| ||| |||| ||||||||||||| |||||||||||||| ||| |||||   |     
45736356 tgttgattttgttttggatttcaagtttgttgttcaacgttttaatttaaatctagatgatagcagtgaattaggttgtattatttaggtttgtaggcaa 45736455  T
116 ttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgcta 215  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||  ||||||||  ||||| | |||||||||||||| || ||||||||||||    
45736456 ttgttcgattgtaattttcagaactctcatgtcgagttcaataggaggcagaccaatgggaacgctcgtaaattagctagggtagcctcatctcatgcta 45736555  T
216 gctcccacgtttatgatgatgt 237  Q
     |||||||||||||||||||||    
45736556 actcccacgtttatgatgatgt 45736577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 4 - 234
Target Start/End: Complemental strand, 4978648 - 4978417
Alignment:
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgtt-gaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattca 102  Q
    ||||| |||||||||| ||||||||||||||| ||| | ||||||| ||||||||||||||||||||||||||||  ||| ||||||||||||||||||     
4978648 tcattctgacaatgttaattttgttttggattccaaatatgttgtttgaacgttttaattcaaacctaggtgataatagtaaactaggttgtattattct 4978549  T
103 ggcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaacc 202  Q
    ||||||||   | ||||||| || | ||||||||||||||||||||||||| |||| ||| |||||||||| ||||| ||||||||||||||| ||| ||    
4978548 ggcttgtaggcacttgttcggttataattttcagaactctcatgtcgagtttaatatgagacaagccaatgaggtcgttcatgaattagctagcgtagcc 4978449  T
203 ccatctcatgctagctcccacgtttatgatga 234  Q
     |||||||||||| ||| | | ||||||||||    
4978448 acatctcatgctaactcgcgcatttatgatga 4978417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 53 - 199
Target Start/End: Complemental strand, 49759102 - 49758956
Alignment:
53 cgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcaggcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagt 152  Q
    |||||||||||||||||||  ||||| |||||||||||||| ||||||||| ||||||    |||| | | |||| |||||||||||||| |||||| ||    
49759102 cgttttaattcaaacctagaggatagtagtgaactaggttgcattattcagacttgtaggctgttgcttgcttgtaattttcagaactcttatgtcgggt 49759003  T
153 tcaataggaggcaagccaatggggtcgctcatgaattagctagggta 199  Q
    |||||||||||||||| |||||| |||||||||||||  ||||||||    
49759002 tcaataggaggcaagctaatgggatcgctcatgaattgactagggta 49758956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 130 - 237
Target Start/End: Complemental strand, 47165452 - 47165345
Alignment:
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttat 229  Q
    ||||||||  ||||| |||||||||||||||||||||| |||||||||||||| ||||||||  | || | ||||||||||||||||||||||||||||     
47165452 ttttcagagttctcacgtcgagttcaataggaggcaagtcaatggggtcgctcgtgaattaggaaaggcagccccatctcatgctagctcccacgtttac 47165353  T
230 gatgatgt 237  Q
    | ||||||    
47165352 ggtgatgt 47165345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 130 - 207
Target Start/End: Original strand, 38998911 - 38998988
Alignment:
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatc 207  Q
    |||||| ||||||||||||||||| |||||||||||||| |||||||||||||| |||||||| |||||| |||||||    
38998911 ttttcaaaactctcatgtcgagtttaataggaggcaagctaatggggtcgctcacgaattagcgagggtagccccatc 38998988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 130 - 237
Target Start/End: Original strand, 37796609 - 37796716
Alignment:
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttat 229  Q
    |||||| ||| ||||||||||||| |||||||||||||| |||| |||||||||  ||||||| |||||| |||||||| || ||||| ||  | |||||    
37796609 ttttcaaaacactcatgtcgagtttaataggaggcaagctaatgaggtcgctcacaaattagcgagggtagccccatctgatcctagccccaccatttat 37796708  T
230 gatgatgt 237  Q
    ||||||||    
37796709 gatgatgt 37796716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 8 - 164
Target Start/End: Complemental strand, 26390956 - 26390800
Alignment:
8 tatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcaggctt 107  Q
    ||||| ||||| || |||| |||||||| ||||    |||| || |||||||| | ||||||||  ||||| |||||||||||||| ||||| || ||||    
26390956 tatgataatgtcgactttgctttggatttcaaggcacttgtagatcgttttaactgaaacctagaagatagtagtgaactaggttgcattatacaagctt 26390857  T
108 gtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggc 164  Q
    ||| | ||||||| | ||||  |||| | ||||||| ||||||||||||||||||||    
26390856 gtagacagttgtttgcttgtagtttttataactctcgtgtcgagttcaataggaggc 26390800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 104 - 182
Target Start/End: Original strand, 20916387 - 20916465
Alignment:
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctc 182  Q
    |||||||||| ||| || ||| ||  ||||||||||||| |||| |||||||||||||||||||| |||| ||||||||    
20916387 gcttgtaaattgttattagatagtagttttcagaactcttatgttgagttcaataggaggcaagcgaatgaggtcgctc 20916465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 104 - 182
Target Start/End: Original strand, 20925349 - 20925427
Alignment:
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctc 182  Q
    |||||||||| ||| || ||| ||  ||||||||||||| |||| |||||||||||||||||||| |||| ||||||||    
20925349 gcttgtaaattgttattagatagtagttttcagaactcttatgttgagttcaataggaggcaagcgaatgaggtcgctc 20925427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 194
Target Start/End: Complemental strand, 32073664 - 32073607
Alignment:
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||||| | |||||||||||| |||| ||| ||||||||||||||||    
32073664 aactctcatgtcgagtttactaggaggcaagcaaatgaggttgctcatgaattagcta 32073607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 131 - 193
Target Start/End: Complemental strand, 10346589 - 10346527
Alignment:
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagct 193  Q
    ||||||||||| ||||| |||||||| ||||||||||| ||| |||||||||| || ||||||    
10346589 tttcagaactcgcatgtagagttcaacaggaggcaagcgaatagggtcgctcacgagttagct 10346527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 193
Target Start/End: Complemental strand, 1017732 - 1017670
Alignment:
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagct 193  Q
    ||||||||||||||||| ||||||||  |||||||||| ||| |||| ||||| || ||||||    
1017732 tttcagaactctcatgttgagttcaaccggaggcaagcaaatagggtagctcacgagttagct 1017670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 130 - 184
Target Start/End: Complemental strand, 25131140 - 25131086
Alignment:
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcat 184  Q
    ||||| |||||||||||||||||||||||| | | |||  |||||||||||||||    
25131140 ttttctgaactctcatgtcgagttcaatagaaagtaagttaatggggtcgctcat 25131086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 131 - 220
Target Start/End: Original strand, 29237227 - 29237316
Alignment:
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcc 220  Q
    ||||| ||||| |||||||||| |||||| |||||||| |||| |||| ||   || ||||||  |||| |||||| |||||||||||||    
29237227 tttcaaaactcacatgtcgagtgcaatagaaggcaagctaatgaggtcacttgcgagttagctcaggtagccccatgtcatgctagctcc 29237316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 15)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 4 - 237
Target Start/End: Complemental strand, 43989490 - 43989258
Alignment:
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 103  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43989490 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 43989391  T
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccc 203  Q
    ||||| | | | ||||||||||| |||||| ||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||    
43989390 gcttgcagacaattgttcgattg-tatttttagaacgctcatgtcgagttcaataggaggcaagccaatgaggtcgctcatgaattagttagggtagccc 43989292  T
204 catctcatgctagctcccacgtttatgatgatgt 237  Q
    ||||||||||||||||||||||||||||||||||    
43989291 catctcatgctagctcccacgtttatgatgatgt 43989258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 56 - 237
Target Start/End: Complemental strand, 19316071 - 19315890
Alignment:
56 tttaattcaaacctaggtgatagcagtgaactaggttgtattattcaggcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttca 155  Q
    ||||| |||||  ||| |||||| ||||| |||||||| ||||| || ||||||| ||||||||| | |     ||||||||||||||||||||||||||    
19316071 tttaagtcaaatgtagatgatagtagtgagctaggttgcattatacatgcttgtagatagttgtttgttaacagttttcagaactctcatgtcgagttca 19315972  T
156 ataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttatgatgatgt 237  Q
    ||||||||||||||||||| |||| ||||||||||||   |||| ||||| || ||| ||||||||||| ||||||| ||||    
19315971 ataggaggcaagccaatggagtcgttcatgaattagcacaggtagccccaccttatggtagctcccacgcttatgattatgt 19315890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 141 - 237
Target Start/End: Complemental strand, 43813267 - 43813171
Alignment:
141 ctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttatgatgatgt 237  Q
    ||||||||||||||||||| || |||| ||||||||||| ||||||||||| ||||||| ||||||||||| ||||||| | ||||| |||||||||    
43813267 ctcatgtcgagttcaatagcagacaagtcaatggggtcgttcatgaattagttagggtagccccatctcatactagctctctcgtttttgatgatgt 43813171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 130 - 232
Target Start/End: Original strand, 1394129 - 1394232
Alignment:
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggta-accccatctcatgctagctcccacgttta 228  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||    |||  |||||||| |||||||||||||| | ||    
1394129 ttttcagaactctcatgtcgagttcaataggaggcaagctaatggggtcgttcatgaattagcacaagtagtccccatctaatgctagctcccacatcta 1394228  T
229 tgat 232  Q
    ||||    
1394229 tgat 1394232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 131 - 179
Target Start/End: Original strand, 9633063 - 9633111
Alignment:
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcg 179  Q
    |||||||||||||||||||||||||||||||||||||  ||||||||||    
9633063 tttcagaactctcatgtcgagttcaataggaggcaagtgaatggggtcg 9633111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 131 - 193
Target Start/End: Original strand, 35096913 - 35096975
Alignment:
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagct 193  Q
    ||||||||||||||||||||||||||||| |||||||| ||| |||| ||||| || ||||||    
35096913 tttcagaactctcatgtcgagttcaatagaaggcaagcaaatagggttgctcacgagttagct 35096975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 194
Target Start/End: Original strand, 13200849 - 13200906
Alignment:
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||||||| |||||||||||| |||| ||| |||||||| |||||||    
13200849 aactctcatgtcgagttcattaggaggcaagcaaatgaggttgctcatgagttagcta 13200906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 194
Target Start/End: Original strand, 47783000 - 47783057
Alignment:
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||||| | |||||||||||| |||| ||| ||||||||||||||||    
47783000 aactctcatgtcgagtttactaggaggcaagcaaatgaggttgctcatgaattagcta 47783057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 131 - 183
Target Start/End: Complemental strand, 1479337 - 1479285
Alignment:
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctca 183  Q
    ||||||||||||||| |||||||||||||||||||||  ||||||||| ||||    
1479337 tttcagaactctcatatcgagttcaataggaggcaagtaaatggggtcactca 1479285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 131 - 193
Target Start/End: Original strand, 6969614 - 6969676
Alignment:
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagct 193  Q
    |||||||||||||||||||| ||||||| |||| |||  |||||||||||||| || ||||||    
6969614 tttcagaactctcatgtcgatttcaataagaggtaagtaaatggggtcgctcacgagttagct 6969676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 131 - 177
Target Start/End: Complemental strand, 17283627 - 17283581
Alignment:
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggt 177  Q
    |||||||||||| ||||||||||||||||||||||| | ||||||||    
17283627 tttcagaactcttatgtcgagttcaataggaggcaaacgaatggggt 17283581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 129 - 174
Target Start/End: Complemental strand, 5124688 - 5124643
Alignment:
129 attttcagaactctcatgtcgagttcaataggaggcaagccaatgg 174  Q
    |||||||||||||| |||||||||||||| |||||||||| |||||    
5124688 attttcagaactctaatgtcgagttcaatcggaggcaagctaatgg 5124643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 36469295 - 36469374
Alignment:
157 taggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttatgatgatgt 237  Q
    |||||||||||| ||||||||| |  | ||||||   ||||||||||||||||| ||||||||| || |||||||||||||    
36469295 taggaggcaagctaatggggtcacg-aggaattaataagggtaaccccatctcaagctagctcctacatttatgatgatgt 36469374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 193
Target Start/End: Original strand, 16889147 - 16889209
Alignment:
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagct 193  Q
    ||||||||||||||||| ||||||| | |||||||||| ||| |||| ||||| || ||||||    
16889147 tttcagaactctcatgttgagttcagtcggaggcaagcaaatagggtagctcacgagttagct 16889209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 193
Target Start/End: Complemental strand, 37857076 - 37857014
Alignment:
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagct 193  Q
    ||||||||||||||||| |||||||| ||||||||||| ||| | || ||||| || ||||||    
37857076 tttcagaactctcatgttgagttcaacaggaggcaagcaaatagagtagctcacgagttagct 37857014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 174; Significance: 1e-93; HSPs: 9)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 4 - 237
Target Start/End: Original strand, 942571 - 942804
Alignment:
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 103  Q
    |||||||||||||||||||||||||||||||| ||||| ||||||||||| |||||| ||||||||||||||||| ||||||||||||||||||||||||    
942571 tcattatgacaatgttgattttgttttggattccaagtctgttgttgaacattttaagtcaaacctaggtgatagtagtgaactaggttgtattattcag 942670  T
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccc 203  Q
    |||||||   |||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||  |||||    
942671 gcttgtaggcagttgttcgattgtaattttcagaactctaatgtcgagttcaataggaggcaagccaatggggtcgctcgtgaattagctaggacaaccc 942770  T
204 catctcatgctagctcccacgtttatgatgatgt 237  Q
    |||||||||||| |||||||||||| ||||||||    
942771 catctcatgctatctcccacgtttacgatgatgt 942804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 130 - 237
Target Start/End: Original strand, 4513076 - 4513183
Alignment:
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttat 229  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||| ||||||    
4513076 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctaatgaattagctagggtagccccatctcatactagctcccatgtttat 4513175  T
230 gatgatgt 237  Q
    ||| ||||    
4513176 gataatgt 4513183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 131 - 217
Target Start/End: Original strand, 19047092 - 19047178
Alignment:
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagc 217  Q
    ||||| ||||||||||||||||| |||||||||||||| |||| ||||||||| |||||||| |||||| ||| |||| || |||||    
19047092 tttcaaaactctcatgtcgagtttaataggaggcaagctaatgtggtcgctcacgaattagcgagggtagccctatctgatcctagc 19047178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 194
Target Start/End: Original strand, 15950809 - 15950866
Alignment:
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||||| | |||||||||||| |||| ||| ||||||||||||||||    
15950809 aactctcatgtcgagtttactaggaggcaagcaaatgaggttgctcatgaattagcta 15950866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 130 - 237
Target Start/End: Original strand, 12125820 - 12125927
Alignment:
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttat 229  Q
    ||||||||| ||||||||  | ||||||| ||||||||| ||||  || ||||||||||||||    ||| || ||||||||||||||| ||| || |||    
12125820 ttttcagaattctcatgttcaattcaatatgaggcaagctaatgaagtggctcatgaattagcacatgtagcctcatctcatgctagcttccatgtctat 12125919  T
230 gatgatgt 237  Q
    ||||||||    
12125920 gatgatgt 12125927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 131 - 235
Target Start/End: Complemental strand, 13757607 - 13757503
Alignment:
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttatg 230  Q
    ||||| ||||||||||| ||||| |||| || |||| | |||| ||||||||| |||||||||||| || | |||| | || |||||||| |  ||||||    
13757607 tttcaaaactctcatgttgagtttaataagaagcaaactaatgaggtcgctcacgaattagctaggatagctccatataatcctagctccaatttttatg 13757508  T
231 atgat 235  Q
    |||||    
13757507 atgat 13757503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 237
Target Start/End: Complemental strand, 20731771 - 20731689
Alignment:
155 aataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttatgatgatgt 237  Q
    |||||||||||||| || || |  |||||||||||||| |||||||||| || | ||||| ||| |||| |||| ||||||||    
20731771 aataggaggcaagctaacggagatgctcatgaattagcgagggtaacccaatgtgatgctcgcttccacatttaagatgatgt 20731689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 137 - 194
Target Start/End: Original strand, 21698719 - 21698776
Alignment:
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||||| | |||||||||||| |||| ||| |||||||  |||||||    
21698719 aactctcatgtcgagtttattaggaggcaagcaaatgaggttgctcatgttttagcta 21698776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 137 - 194
Target Start/End: Complemental strand, 30063723 - 30063666
Alignment:
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||||| | |||||||||||| |||| ||| |||||||  |||||||    
30063723 aactctcatgtcgagtttattaggaggcaagcaaatgaggttgctcatgttttagcta 30063666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 163; Significance: 4e-87; HSPs: 12)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 43 - 237
Target Start/End: Complemental strand, 41197550 - 41197356
Alignment:
43 tgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcaggcttgtaaatagttgttcgattgttattttcagaactct 142  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| || | |||||||||||||| ||||||||||||||    
41197550 tgttgttgaacattttaattcaaacctaggtgatagcagtgaactaggttgtattatttaggcttatagacagttgttcgattgtaattttcagaactct 41197451  T
143 catgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttatgatgatgt 237  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
41197450 tatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtagccccatctcatgctagctcccacgtttatgatgatgt 41197356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 15 - 237
Target Start/End: Complemental strand, 36779622 - 36779403
Alignment:
15 atgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcaggcttgtaaata 114  Q
    ||||||||||| ||||||||| ||||| | ||||||||||||||||||||||||||  ||| || ||||||||||||||||||||| |||||||||   |    
36779622 atgttgattttattttggattccaagtctattgttgaacgttttaattcaaacctaattgagagtagtgaactaggttgtattattaaggcttgtaggca 36779523  T
115 gttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgct 214  Q
    |||||| | |||| |  ||||||||||||||||||||| ||||||||||||||||||| | ||| |||||| |||||||||||||  ||||||| ||| |    
36779522 gttgtttggttgtaa--ttcagaactctcatgtcgagtacaataggaggcaagccaatagtgtcactcatggattagctagggtagtcccatct-atgtt 36779426  T
215 agctcccacgtttatgatgatgt 237  Q
    ||||||||||| |||||||||||    
36779425 agctcccacgtctatgatgatgt 36779403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 114 - 237
Target Start/End: Complemental strand, 30376550 - 30376427
Alignment:
114 agttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgc 213  Q
    |||||||||||| | ||||||| |||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| || ||||||||||    
30376550 agttgttcgattataattttcaaaactcttatgtcgagttcaataggaggcaagccaatagggtcgctcatgaattagctacggtagcctcatctcatgc 30376451  T
214 tagctcccacgtttatgatgatgt 237  Q
    ||||||| ||||||||||||||||    
30376450 tagctccaacgtttatgatgatgt 30376427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 130 - 237
Target Start/End: Complemental strand, 12714954 - 12714847
Alignment:
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttat 229  Q
    |||||||||||||||||| | |||||| |||| |||| | |||||||||| |||| |||||||   |||||||||||| ||||||||||| || ||||||    
12714954 ttttcagaactctcatgttgggttcaaaaggaagcaacctaatggggtcgttcataaattagcagaggtaaccccatcacatgctagctctcatgtttat 12714855  T
230 gatgatgt 237  Q
    ||||||||    
12714854 gatgatgt 12714847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 130 - 237
Target Start/End: Complemental strand, 12776185 - 12776078
Alignment:
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttat 229  Q
    |||||||||||||||||| | |||||| |||| |||| | |||||||||| |||| |||||||   |||||||||||| ||||||||||| || ||||||    
12776185 ttttcagaactctcatgttgggttcaaaaggaagcaacctaatggggtcgttcataaattagcagaggtaaccccatcacatgctagctctcatgtttat 12776086  T
230 gatgatgt 237  Q
    ||||||||    
12776085 gatgatgt 12776078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 185 - 237
Target Start/End: Complemental strand, 12378660 - 12378608
Alignment:
185 gaattagctagggtaaccccatctcatgctagctcccacgtttatgatgatgt 237  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||    
12378660 gaattagctagggtagccccatctcatgctagctcccacgtttatgatgatgt 12378608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 80 - 236
Target Start/End: Original strand, 34905529 - 34905685
Alignment:
80 agtgaactaggttgtattattcaggcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcg 179  Q
    ||||| ||||||||| |||| || ||||||| | ||||||| | |  |  |||||||||||||  ||| |||||||||||||| ||| |||||| |||||    
34905529 agtgagctaggttgtgttatacatgcttgtagacagttgtttgttaatagttttcagaactcttgtgttgagttcaataggagacaaaccaatgaggtcg 34905628  T
180 ctcatgaattagctagggtaaccccatctcatgctagctcccacgtttatgatgatg 236  Q
    |||||||||||||    ||| ||| ||||||||||| |||||| ||||| |||||||    
34905629 ctcatgaattagcccaagtagcccgatctcatgctaactcccaagtttacgatgatg 34905685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 130 - 183
Target Start/End: Original strand, 34525 - 34578
Alignment:
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctca 183  Q
    |||||||||||||||||||||||| ||||||| ||||||||||  |||||||||    
34525 ttttcagaactctcatgtcgagtttaataggaagcaagccaatatggtcgctca 34578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 131 - 207
Target Start/End: Complemental strand, 14857028 - 14856952
Alignment:
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatc 207  Q
    ||||| ||||||||||||||||| |||| ||||||| | |||| | |||||||||||||||||| || | |||||||    
14857028 tttcaaaactctcatgtcgagtttaatatgaggcaaacaaatgtgatcgctcatgaattagctaaggcatccccatc 14856952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 133 - 228
Target Start/End: Original strand, 29985435 - 29985530
Alignment:
133 tcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgttta 228  Q
    ||||||||||||||||||||||||||| || ||||| |||| ||||| ||| || ||||||  |||| ||| |  ||||| |||||||||| ||||    
29985435 tcagaactctcatgtcgagttcaatagaagacaagctaatgaggtcgttcacgagttagctcaggtagccctaggtcatgttagctcccacattta 29985530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 137 - 194
Target Start/End: Complemental strand, 19609213 - 19609156
Alignment:
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||||| | |||||||||||| |||| ||| |||||||  |||||||    
19609213 aactctcatgtcgagtttattaggaggcaagcaaatgaggttgctcatgttttagcta 19609156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 176 - 237
Target Start/End: Original strand, 39714874 - 39714935
Alignment:
176 gtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttatgatgatgt 237  Q
    |||||||||||||||| ||| ||| ||||| || ||  |||||| |||||||||||||||||    
39714874 gtcgctcatgaattagttagtgtagccccaccttatattagctctcacgtttatgatgatgt 39714935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 12)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 4 - 237
Target Start/End: Original strand, 23820401 - 23820634
Alignment:
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 103  Q
    |||||||||| ||||| ||||||||||||||| ||||| |||||||| ||  ||||||||||||||||||||||| ||||||||||||||||| ||||||    
23820401 tcattatgaccatgttaattttgttttggattccaagtctgttgttgtacactttaattcaaacctaggtgatagtagtgaactaggttgtatcattcag 23820500  T
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccc 203  Q
    | |||||   ||||||| |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||   |    
23820501 gtttgtaggcagttgtttgattgtaattttcagaactctcatatcgagttcaataggaggcaagccaatggggtcgctcatgaattagatagggtagatc 23820600  T
204 catctcatgctagctcccacgtttatgatgatgt 237  Q
    |||||||||||||||||||| |||||||||||||    
23820601 catctcatgctagctcccacatttatgatgatgt 23820634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 8 - 237
Target Start/End: Complemental strand, 24808980 - 24808771
Alignment:
8 tatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcaggctt 107  Q
    |||||| |||||||||||||||| |||| ||||| ||||||||| ||||||||||||||||||| |||||| ||||||||||||||||||||||||||||    
24808980 tatgaccatgttgattttgttttagattccaagtctgttgttgatcgttttaattcaaacctagttgatagtagtgaactaggttgtattattcaggctt 24808881  T
108 gtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatc 207  Q
    |||   ||||||| | ||||         |||        | ||||||||||||||||||||||||||| | ||||||||||||||||| || |||||||    
24808880 gtaggcagttgtttggttgt---------aac--------ctagttcaataggaggcaagccaatggggccactcatgaattagctaggatagccccatc 24808798  T
208 tcatgctagctcccacgtttatgatgatgt 237  Q
    |||||||||   ||||||||||||||||||    
24808797 tcatgctag---ccacgtttatgatgatgt 24808771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 130 - 237
Target Start/End: Original strand, 21118399 - 21118505
Alignment:
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttat 229  Q
    ||||||||||||||||||||||||||||||||||||||| |||| |||| ||||||  |||||||||||| | ||||||  |||||||||| ||||||||    
21118399 ttttcagaactctcatgtcgagttcaataggaggcaagctaatgaggtcactcatg-gttagctagggtagcaccatctattgctagctccaacgtttat 21118497  T
230 gatgatgt 237  Q
    ||| ||||    
21118498 gataatgt 21118505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 134 - 239
Target Start/End: Complemental strand, 40901908 - 40901803
Alignment:
134 cagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttatgatg 233  Q
    |||||||||||||||||||| |||||||||||| | |||  |||||||||||||||| |   |||| | ||||||||||||||||||||  | |||||||    
40901908 cagaactctcatgtcgagttgaataggaggcaaactaatatggtcgctcatgaattaacacaggtagctccatctcatgctagctcccatatctatgatg 40901809  T
234 atgtcc 239  Q
    ||||||    
40901808 atgtcc 40901803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 131 - 183
Target Start/End: Original strand, 12980735 - 12980787
Alignment:
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctca 183  Q
    |||||||||||||||||||||||||| ||||||||| | ||||||||||||||    
12980735 tttcagaactctcatgtcgagttcaacaggaggcaaacgaatggggtcgctca 12980787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 135 - 193
Target Start/End: Original strand, 20492489 - 20492547
Alignment:
135 agaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagct 193  Q
    ||||||||||| ||||||| |||||||||||||| ||| |||||||||| |||||||||    
20492489 agaactctcatctcgagtttaataggaggcaagcgaatagggtcgctcacgaattagct 20492547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 194
Target Start/End: Original strand, 29526837 - 29526894
Alignment:
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||||| | |||||||||||| |||| ||| ||||||||||||||||    
29526837 aactctcatgtcgagtttactaggaggcaagcaaatgaggttgctcatgaattagcta 29526894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 137 - 193
Target Start/End: Complemental strand, 10325166 - 10325110
Alignment:
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagct 193  Q
    ||||||||||||||||| |||||||||||| | |||| |||||||||||| ||||||    
10325166 aactctcatgtcgagtttaataggaggcaaacgaatgaggtcgctcatgagttagct 10325110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 130 - 180
Target Start/End: Complemental strand, 31957100 - 31957050
Alignment:
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgc 180  Q
    ||||||||||| ||||||||| ||||||||||||||||  |||||| ||||    
31957100 ttttcagaactatcatgtcgaattcaataggaggcaagttaatgggatcgc 31957050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 137 - 194
Target Start/End: Complemental strand, 665047 - 664990
Alignment:
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||||| | |||||| ||||| |||| ||| || |||||||||||||    
665047 aactctcatgtcgagtttattaggagacaagcaaatgaggttgcacatgaattagcta 664990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 137 - 194
Target Start/End: Complemental strand, 21588208 - 21588151
Alignment:
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||||| | |||||||||| | |||| ||| || |||||||||||||    
21588208 aactctcatgtcgagtttattaggaggcaatcaaatgaggttgcacatgaattagcta 21588151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 131 - 191
Target Start/End: Complemental strand, 8321252 - 8321192
Alignment:
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattag 191  Q
    ||||| |||||||||||||| || |||| ||| ||| | || |||||||||||||||||||    
8321252 tttcaaaactctcatgtcgaatttaatacgagacaaacaaacggggtcgctcatgaattag 8321192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: scaffold0041
Description:

Target: scaffold0041; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 134 - 239
Target Start/End: Original strand, 48110 - 48215
Alignment:
134 cagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttatgatg 233  Q
    |||||||||||||||||||| |||||||||||| | |||  |||||||||||||||| |   |||| | ||||||||||||||||||||  | |||||||    
48110 cagaactctcatgtcgagttgaataggaggcaaactaatatggtcgctcatgaattaacacaggtagctccatctcatgctagctcccatatctatgatg 48209  T
234 atgtcc 239  Q
    ||||||    
48210 atgtcc 48215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 111541 times since January 2019
Visitors: 1375