View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_low_63 (Length: 257)

Name: NF0945_low_63
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0945_low_63
[»] chr2 (5 HSPs)
chr2 (4-237)||(24543091-24543324)
chr2 (4-237)||(29894321-29894554)
chr2 (4-237)||(36364918-36365151)
chr2 (130-237)||(40287017-40287124)
chr2 (130-181)||(12555415-12555466)
[»] chr1 (18 HSPs)
chr1 (4-237)||(11351597-11351830)
chr1 (7-237)||(6784159-6784389)
chr1 (22-237)||(21515101-21515314)
chr1 (4-201)||(20639468-20639665)
chr1 (4-237)||(32988886-32989121)
chr1 (130-230)||(2536489-2536589)
chr1 (130-237)||(44839857-44839964)
chr1 (130-208)||(51080701-51080779)
chr1 (132-218)||(39648376-39648462)
chr1 (131-193)||(2114361-2114423)
chr1 (131-193)||(3601265-3601327)
chr1 (131-193)||(17321880-17321942)
chr1 (137-194)||(26418788-26418845)
chr1 (137-194)||(32108435-32108492)
chr1 (131-193)||(12539121-12539183)
chr1 (171-237)||(52823473-52823539)
chr1 (139-194)||(5811388-5811443)
chr1 (137-185)||(4179980-4180028)
[»] chr8 (5 HSPs)
chr8 (4-237)||(18481111-18481344)
chr8 (6-207)||(32536156-32536357)
chr8 (130-237)||(26440810-26440917)
chr8 (130-237)||(7251110-7251217)
chr8 (130-219)||(11911382-11911471)
[»] chr3 (18 HSPs)
chr3 (4-237)||(36684783-36685016)
chr3 (4-237)||(51976638-51976871)
chr3 (8-237)||(8705594-8705823)
chr3 (8-237)||(9057481-9057710)
chr3 (16-237)||(45736356-45736577)
chr3 (4-234)||(4978417-4978648)
chr3 (53-199)||(49758956-49759102)
chr3 (130-237)||(47165345-47165452)
chr3 (130-207)||(38998911-38998988)
chr3 (130-237)||(37796609-37796716)
chr3 (8-164)||(26390800-26390956)
chr3 (104-182)||(20916387-20916465)
chr3 (104-182)||(20925349-20925427)
chr3 (137-194)||(32073607-32073664)
chr3 (131-193)||(10346527-10346589)
chr3 (131-193)||(1017670-1017732)
chr3 (130-184)||(25131086-25131140)
chr3 (131-220)||(29237227-29237316)
[»] chr4 (15 HSPs)
chr4 (4-237)||(43989258-43989490)
chr4 (56-237)||(19315890-19316071)
chr4 (141-237)||(43813171-43813267)
chr4 (130-232)||(1394129-1394232)
chr4 (131-179)||(9633063-9633111)
chr4 (131-193)||(35096913-35096975)
chr4 (137-194)||(13200849-13200906)
chr4 (137-194)||(47783000-47783057)
chr4 (131-183)||(1479285-1479337)
chr4 (131-193)||(6969614-6969676)
chr4 (131-177)||(17283581-17283627)
chr4 (129-174)||(5124643-5124688)
chr4 (157-237)||(36469295-36469374)
chr4 (131-193)||(16889147-16889209)
chr4 (131-193)||(37857014-37857076)
[»] chr6 (9 HSPs)
chr6 (4-237)||(942571-942804)
chr6 (130-237)||(4513076-4513183)
chr6 (131-217)||(19047092-19047178)
chr6 (137-194)||(15950809-15950866)
chr6 (130-237)||(12125820-12125927)
chr6 (131-235)||(13757503-13757607)
chr6 (155-237)||(20731689-20731771)
chr6 (137-194)||(21698719-21698776)
chr6 (137-194)||(30063666-30063723)
[»] chr5 (12 HSPs)
chr5 (43-237)||(41197356-41197550)
chr5 (15-237)||(36779403-36779622)
chr5 (114-237)||(30376427-30376550)
chr5 (130-237)||(12714847-12714954)
chr5 (130-237)||(12776078-12776185)
chr5 (185-237)||(12378608-12378660)
chr5 (80-236)||(34905529-34905685)
chr5 (130-183)||(34525-34578)
chr5 (131-207)||(14856952-14857028)
chr5 (133-228)||(29985435-29985530)
chr5 (137-194)||(19609156-19609213)
chr5 (176-237)||(39714874-39714935)
[»] chr7 (12 HSPs)
chr7 (4-237)||(23820401-23820634)
chr7 (8-237)||(24808771-24808980)
chr7 (130-237)||(21118399-21118505)
chr7 (134-239)||(40901803-40901908)
chr7 (131-183)||(12980735-12980787)
chr7 (135-193)||(20492489-20492547)
chr7 (137-194)||(29526837-29526894)
chr7 (137-193)||(10325110-10325166)
chr7 (130-180)||(31957050-31957100)
chr7 (137-194)||(664990-665047)
chr7 (137-194)||(21588151-21588208)
chr7 (131-191)||(8321192-8321252)
[»] scaffold0041 (1 HSPs)
scaffold0041 (134-239)||(48110-48215)

Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 5)
Name: chr2

Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 4 - 237
Target Start/End: Original strand, 24543091 - 24543324
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 103  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
24543091 tcattatgacaatgttgattttgttttggattgcaagtctgttgttgaacattttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 24543190  T
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccc 203  Q
    ||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||    
24543191 gcttgtagatagttgttcgattgtaattttcagaactctcatgtcgagttcaataggatgcaagccaatggggtcgctcatgaattagctagggtagccc 24543290  T
204 catctcatgctagctcccacgtttatgatgatgt 237  Q
24543291 catctcatgctagctcccacgtttatgatgatgt 24543324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 4 - 237
Target Start/End: Complemental strand, 29894554 - 29894321
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 103  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||    
29894554 tcattatgacaatgttgattttgttttggattgcaagtctgttgttgaacattttaattcaaacctaggtgatagcagtgaactagattgtattattcag 29894455  T
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccc 203  Q
    ||||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
29894454 gcttgtagacagttgttcgattgtaattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtagccc 29894355  T
204 catctcatgctagctcccacgtttatgatgatgt 237  Q
29894354 catctcatgctagctcccacgtttatgatgatgt 29894321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 4 - 237
Target Start/End: Original strand, 36364918 - 36365151
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 103  Q
    |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
36364918 tcattatgacaatgttgattttgttttggattccaagtctgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcat 36365017  T
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccc 203  Q
     ||||||   |||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||    
36365018 acttgtaggcagttgttcgattgtcattttcagaactcccatgtcgagttcaataggaggcaagccaatgaggtcgctcatgaattagctagggtagccc 36365117  T
204 catctcatgctagctcccacgtttatgatgatgt 237  Q
    ||||||||||||||||||||||||||| ||||||    
36365118 catctcatgctagctcccacgtttatggtgatgt 36365151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 130 - 237
Target Start/End: Complemental strand, 40287124 - 40287017
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttat 229  Q
    |||||| |||||||||||| |||| |||| ||||||||| ||||||||| ||||||||||||| |||||| |||||||| || ||||| ||  | |||||    
40287124 ttttcaaaactctcatgtcaagtttaatatgaggcaagctaatggggtcactcatgaattagcgagggtagccccatctgatcctagccccaccatttat 40287025  T
230 gatgatgt 237  Q
40287024 gatgatgt 40287017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 130 - 181
Target Start/End: Complemental strand, 12555466 - 12555415
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgct 181  Q
    ||||||||||||||||||| ||||||||||||||||||  ||||||||||||    
12555466 ttttcagaactctcatgtcaagttcaataggaggcaagttaatggggtcgct 12555415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 18)
Name: chr1

Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 4 - 237
Target Start/End: Complemental strand, 11351830 - 11351597
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 103  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
11351830 tcattatgacaatgttgattttgttttggattgcaagtctgttgttgaacattttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 11351731  T
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccc 203  Q
    ||||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
11351730 gcttgtagacagttgttcgattgtaattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtagccc 11351631  T
204 catctcatgctagctcccacgtttatgatgatgt 237  Q
    ||||||||||||||| ||||||||||||||||||    
11351630 catctcatgctagcttccacgtttatgatgatgt 11351597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 7 - 237
Target Start/End: Original strand, 6784159 - 6784389
7 ttatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcaggct 106  Q
    ||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
6784159 ttatgacaatgttgattttgttttggattgcaagtctcttgttgaacgttttaatttaaacctaggtgatagcagtgaactaggttgtattattcaggct 6784258  T
107 tgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccat 206  Q
    |||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| | ||||    
6784259 tgtagacagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgcttatgaattaactagggtagctccat 6784358  T
207 ctcatgctagctcccacgtttatgatgatgt 237  Q
    ||||| |||||| ||||||||||||| ||||    
6784359 ctcatactagcttccacgtttatgataatgt 6784389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 22 - 237
Target Start/End: Original strand, 21515101 - 21515314
22 ttttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcaggcttgtaaatagttgttc 121  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||   ||||||||    
21515101 ttttgttttggattgcaagtctgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtatttttcaggtttgtaggcagttgttc 21515200  T
122 gattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctccc 221  Q
    || ||| |||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
21515201 gaatgtaattttcagaactc--atgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtagccccatctcatgctagctccc 21515298  T
222 acgtttatgatgatgt 237  Q
21515299 acgtttatgatgatgt 21515314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 4 - 201
Target Start/End: Original strand, 20639468 - 20639665
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 103  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||    
20639468 tcattatgacaatgttgattttgttttggattccaagtttgttgttgaacattttaattcaaacctaggtgatagtagtgaactaggttgtattattcag 20639567  T
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaac 201  Q
    |||||||   |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |||| |||||||||||||||| |||||    
20639568 gcttgtaggcagttgttcgattgtaattttcagaactctcatgttgagttcaataggaggcaagccaatgaggtcactcatgaattagctagtgtaac 20639665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 4 - 237
Target Start/End: Complemental strand, 32989121 - 32988886
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 103  Q
    |||||||||| |||| |||||||||| ||||| ||||| |||||||||||||||||||| |||| || ||||||||||||||||||||||||||||||||    
32989121 tcattatgacgatgtggattttgtttcggattccaagtatgttgttgaacgttttaatttaaacttacgtgatagcagtgaactaggttgtattattcag 32989022  T
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagt----tcaataggaggcaagccaatggggtcgctcatgaattagctagggta 199  Q
     ||||||   |||||||||||||| | ||||||||||||||||||||||    |  |||||||||||||||||    ||||||||||||||| |||||||    
32989021 acttgtaggcagttgttcgattgtaactttcagaactctcatgtcgagttatatatataggaggcaagccaat--tttcgctcatgaattagttagggta 32988924  T
200 accccatctcatgctagctcccacgtttatgatgatgt 237  Q
     |||||||||||||||||| || |||||||||||||||    
32988923 gccccatctcatgctagcttccgcgtttatgatgatgt 32988886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 130 - 230
Target Start/End: Complemental strand, 2536589 - 2536489
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttat 229  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| ||||||    
2536589 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagttagggtagccccatctcatgctagctcccatgtttat 2536490  T
230 g 230  Q
2536489 g 2536489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 130 - 237
Target Start/End: Complemental strand, 44839964 - 44839857
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttat 229  Q
    ||||||||||||||||||||||||||||||||||||||  ||||||||||||||||| |||||||||||| |||||||| ||||||||||| ||||||||    
44839964 ttttcagaactctcatgtcgagttcaataggaggcaagttaatggggtcgctcatgagttagctagggtagccccatctaatgctagctcctacgtttat 44839865  T
230 gatgatgt 237  Q
    ||| ||||    
44839864 gataatgt 44839857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 130 - 208
Target Start/End: Complemental strand, 51080779 - 51080701
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatct 208  Q
    |||||| ||||||||||||||||| |||||||||||| | ||||||||||||||||||||||| |||||| ||||||||    
51080779 ttttcaaaactctcatgtcgagtttaataggaggcaatctaatggggtcgctcatgaattagcgagggtagccccatct 51080701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 132 - 218
Target Start/End: Complemental strand, 39648462 - 39648376
132 ttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagct 218  Q
    |||||||||||| ||||||||| ||||| || ||||| |||  |||||||||||||||||||  |||| ||||||||||||||||||    
39648462 ttcagaactctcgtgtcgagtttaatagaagtcaagctaattaggtcgctcatgaattagctcaggtagccccatctcatgctagct 39648376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 131 - 193
Target Start/End: Original strand, 2114361 - 2114423
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagct 193  Q
    |||||||||||||||||||||||||| |||| | |||| |||||||||||||| |||||||||    
2114361 tttcagaactctcatgtcgagttcaacaggaaggaagcgaatggggtcgctcacgaattagct 2114423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 131 - 193
Target Start/End: Complemental strand, 3601327 - 3601265
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagct 193  Q
    |||||||||||||||||||||||||||||||||||||| |||| ||| ||||| || ||||||    
3601327 tttcagaactctcatgtcgagttcaataggaggcaagcgaatgaggttgctcacgagttagct 3601265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 131 - 193
Target Start/End: Original strand, 17321880 - 17321942
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagct 193  Q
    |||||||||||||||||||||||||| ||||||||||| ||| |||| ||||| || ||||||    
17321880 tttcagaactctcatgtcgagttcaacaggaggcaagcaaatagggtagctcacgagttagct 17321942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 194
Target Start/End: Complemental strand, 26418845 - 26418788
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||||| | |||||||||||| |||| ||| ||||||||||||||||    
26418845 aactctcatgtcgagtttactaggaggcaagcaaatgaggttgctcatgaattagcta 26418788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 194
Target Start/End: Original strand, 32108435 - 32108492
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||||| | |||||||||||| |||| ||| ||||||||||||||||    
32108435 aactctcatgtcgagtttactaggaggcaagcaaatgaggttgctcatgaattagcta 32108492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 131 - 193
Target Start/End: Original strand, 12539121 - 12539183
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagct 193  Q
    |||||||||||||||||||||||||| ||||||||||| ||| || | ||||| || ||||||    
12539121 tttcagaactctcatgtcgagttcaacaggaggcaagcaaataggatagctcacgagttagct 12539183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 171 - 237
Target Start/End: Complemental strand, 52823539 - 52823473
171 atggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttatgatgatgt 237  Q
    ||||||||||||||||||||| ||||||| | ||||||||| ||| |||| | ||||| ||||||||    
52823539 atggggtcgctcatgaattagttagggtagctccatctcatactaactcctatgtttacgatgatgt 52823473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 139 - 194
Target Start/End: Original strand, 5811388 - 5811443
139 ctctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||| |||||||| ||| | |||||||| |||||| |||||||||    
5811388 ctctcatgtcgagtttaataggagacaaacaaatggggtagctcattaattagcta 5811443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 137 - 185
Target Start/End: Original strand, 4179980 - 4180028
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatg 185  Q
    ||||||||||||||||| | |||||||||||| |||| ||| |||||||    
4179980 aactctcatgtcgagtttattaggaggcaagcaaatgaggttgctcatg 4180028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 5)
Name: chr8

Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 4 - 237
Target Start/End: Original strand, 18481111 - 18481344
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 103  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
18481111 tcattatgacaatgttgattttgttttggattgcaagtctgttgttgaacattttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 18481210  T
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccc 203  Q
    ||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |||||||||| ||||| |||||||||||||| |||    
18481211 gcttgtagatagttgttcgattgtaattttcagaactctcatgtcgagttcaataggaggtaagtcaatggggtcactcataaattagctagggtagccc 18481310  T
204 catctcatgctagctcccacgtttatgatgatgt 237  Q
18481311 catctcatgctagctcccacgtttatgatgatgt 18481344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 6 - 207
Target Start/End: Complemental strand, 32536357 - 32536156
6 attatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcaggc 105  Q
    |||||||  |||| ||||||| |||||||| ||||||| |||| || || ||| ||||||||||||  ||||  ||||||||||||||||||||||||||    
32536357 attatgatcatgtcgattttgctttggattacaagtttattgtagatcgctttcattcaaacctagacgataatagtgaactaggttgtattattcaggc 32536258  T
106 ttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaacccca 205  Q
    ||||||| | ||| | | |||| |||||  ||||||| |||||||||||||| | |  ||||  ||||||||||||| |||||||||||||||| |||||    
32536257 ttgtaaacaattgattgcttgtaattttatgaactcttatgtcgagttcaattgaaaacaagttaatggggtcgctcgtgaattagctagggtagcccca 32536158  T
206 tc 207  Q
32536157 tc 32536156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 130 - 237
Target Start/End: Original strand, 26440810 - 26440917
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttat 229  Q
    |||| |||||||||||||||||||||||||||||||||| |||||||| |||||||| |||||||||||| |||||||| |||||||||| |||| ||||    
26440810 tttttagaactctcatgtcgagttcaataggaggcaagctaatggggttgctcatgagttagctagggtagccccatctaatgctagctctcacgattat 26440909  T
230 gatgatgt 237  Q
    ||| ||||    
26440910 gataatgt 26440917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 130 - 237
Target Start/End: Original strand, 7251110 - 7251217
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttat 229  Q
    ||||||||||||| ||||||||||||||||||||||| |||||||| || |||||| |||| ||| |||| |||||||||||||||||| ||| | ||||    
7251110 ttttcagaactcttatgtcgagttcaataggaggcaaaccaatgggatcactcatgcattaactaaggtagccccatctcatgctagcttccatgattat 7251209  T
230 gatgatgt 237  Q
    ||| ||||    
7251210 gataatgt 7251217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 130 - 219
Target Start/End: Complemental strand, 11911471 - 11911382
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctc 219  Q
    |||||| ||||||||||||||||||||||||||| || | ||||||||| | || || |||||| ||| | |||||| | || |||||||    
11911471 ttttcaaaactctcatgtcgagttcaataggaggtaaacgaatggggtcccccacgagttagctcgggaagccccatttaatcctagctc 11911382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 18)
Name: chr3

Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 4 - 237
Target Start/End: Original strand, 36684783 - 36685016
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 103  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||||    
36684783 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacattttaattcaaacctaggtgatagtagtgaactaggttgtatcattcag 36684882  T
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccc 203  Q
    ||||||| | |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||    
36684883 gcttgtagacagttgttcgattgtaattttcagaactctcatgtcgagttcaataggaggcaagctaatggggtcgctcatgaattagctagggtagccc 36684982  T
204 catctcatgctagctcccacgtttatgatgatgt 237  Q
    |||||||||||||||| |||||||||||||||||    
36684983 catctcatgctagctctcacgtttatgatgatgt 36685016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 4 - 237
Target Start/End: Original strand, 51976638 - 51976871
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 103  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
51976638 tcattatgacaatgttgattttgttttggattgcaagtctgttgttgaacattttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 51976737  T
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccc 203  Q
    ||||||| | ||||||| |||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | |    
51976738 gcttgtagaaagttgtttgattgtaattttcagaactctcatgccgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtagctc 51976837  T
204 catctcatgctagctcccacgtttatgatgatgt 237  Q
51976838 catctcatgctagctcccacgtttatgatgatgt 51976871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 8 - 237
Target Start/End: Original strand, 8705594 - 8705823
8 tatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcaggctt 107  Q
    |||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||    
8705594 tatgaccatgttgattttgttttggattccaagtatgttgttgaacgttttaattcaaacctagttgatagtagtgaactaggttgtattattcaggctt 8705693  T
108 gtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatc 207  Q
    |||   ||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |||| ||||||| ||||||||| ||||||| |||||||    
8705694 gtaggcagttgtttgattgtaattttcagaactctcatgtcgagttcaataggaggcaagctaatgaggtcgcttatgaattagttagggtagccccatc 8705793  T
208 tcatgctagctcccacgtttatgatgatgt 237  Q
    |||| |||||||||||||||||||||||||    
8705794 tcatactagctcccacgtttatgatgatgt 8705823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 8 - 237
Target Start/End: Original strand, 9057481 - 9057710
8 tatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcaggctt 107  Q
    |||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||    
9057481 tatgaccatgttgattttgttttggattccaagtatgttgttgaacgttttaattcaaacctagttgatagtagtgaactaggttgtattattcaggctt 9057580  T
108 gtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatc 207  Q
    |||   ||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |||| ||||||| ||||||||| ||||||| |||||||    
9057581 gtaggcagttgtttgattgtaattttcagaactctcatgtcgagttcaataggaggcaagctaatgaggtcgcttatgaattagttagggtagccccatc 9057680  T
208 tcatgctagctcccacgtttatgatgatgt 237  Q
    |||| |||||||||||||||||||||||||    
9057681 tcatactagctcccacgtttatgatgatgt 9057710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 16 - 237
Target Start/End: Original strand, 45736356 - 45736577
16 tgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcaggcttgtaaatag 115  Q
    |||||||||||||||||||| ||||||||||||| |||||||||||| ||| |||| ||||||||||||| |||||||||||||| ||| |||||   |     
45736356 tgttgattttgttttggatttcaagtttgttgttcaacgttttaatttaaatctagatgatagcagtgaattaggttgtattatttaggtttgtaggcaa 45736455  T
116 ttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgcta 215  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||  ||||||||  ||||| | |||||||||||||| || ||||||||||||    
45736456 ttgttcgattgtaattttcagaactctcatgtcgagttcaataggaggcagaccaatgggaacgctcgtaaattagctagggtagcctcatctcatgcta 45736555  T
216 gctcccacgtttatgatgatgt 237  Q
45736556 actcccacgtttatgatgatgt 45736577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 4 - 234
Target Start/End: Complemental strand, 4978648 - 4978417
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgtt-gaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattca 102  Q
    ||||| |||||||||| ||||||||||||||| ||| | ||||||| ||||||||||||||||||||||||||||  ||| ||||||||||||||||||     
4978648 tcattctgacaatgttaattttgttttggattccaaatatgttgtttgaacgttttaattcaaacctaggtgataatagtaaactaggttgtattattct 4978549  T
103 ggcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaacc 202  Q
    ||||||||   | ||||||| || | ||||||||||||||||||||||||| |||| ||| |||||||||| ||||| ||||||||||||||| ||| ||    
4978548 ggcttgtaggcacttgttcggttataattttcagaactctcatgtcgagtttaatatgagacaagccaatgaggtcgttcatgaattagctagcgtagcc 4978449  T
203 ccatctcatgctagctcccacgtttatgatga 234  Q
     |||||||||||| ||| | | ||||||||||    
4978448 acatctcatgctaactcgcgcatttatgatga 4978417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 53 - 199
Target Start/End: Complemental strand, 49759102 - 49758956
53 cgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcaggcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagt 152  Q
    |||||||||||||||||||  ||||| |||||||||||||| ||||||||| ||||||    |||| | | |||| |||||||||||||| |||||| ||    
49759102 cgttttaattcaaacctagaggatagtagtgaactaggttgcattattcagacttgtaggctgttgcttgcttgtaattttcagaactcttatgtcgggt 49759003  T
153 tcaataggaggcaagccaatggggtcgctcatgaattagctagggta 199  Q
    |||||||||||||||| |||||| |||||||||||||  ||||||||    
49759002 tcaataggaggcaagctaatgggatcgctcatgaattgactagggta 49758956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 130 - 237
Target Start/End: Complemental strand, 47165452 - 47165345
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttat 229  Q
    ||||||||  ||||| |||||||||||||||||||||| |||||||||||||| ||||||||  | || | ||||||||||||||||||||||||||||     
47165452 ttttcagagttctcacgtcgagttcaataggaggcaagtcaatggggtcgctcgtgaattaggaaaggcagccccatctcatgctagctcccacgtttac 47165353  T
230 gatgatgt 237  Q
    | ||||||    
47165352 ggtgatgt 47165345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 130 - 207
Target Start/End: Original strand, 38998911 - 38998988
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatc 207  Q
    |||||| ||||||||||||||||| |||||||||||||| |||||||||||||| |||||||| |||||| |||||||    
38998911 ttttcaaaactctcatgtcgagtttaataggaggcaagctaatggggtcgctcacgaattagcgagggtagccccatc 38998988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 130 - 237
Target Start/End: Original strand, 37796609 - 37796716
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttat 229  Q
    |||||| ||| ||||||||||||| |||||||||||||| |||| |||||||||  ||||||| |||||| |||||||| || ||||| ||  | |||||    
37796609 ttttcaaaacactcatgtcgagtttaataggaggcaagctaatgaggtcgctcacaaattagcgagggtagccccatctgatcctagccccaccatttat 37796708  T
230 gatgatgt 237  Q
37796709 gatgatgt 37796716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 8 - 164
Target Start/End: Complemental strand, 26390956 - 26390800
8 tatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcaggctt 107  Q
    ||||| ||||| || |||| |||||||| ||||    |||| || |||||||| | ||||||||  ||||| |||||||||||||| ||||| || ||||    
26390956 tatgataatgtcgactttgctttggatttcaaggcacttgtagatcgttttaactgaaacctagaagatagtagtgaactaggttgcattatacaagctt 26390857  T
108 gtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggc 164  Q
    ||| | ||||||| | ||||  |||| | ||||||| ||||||||||||||||||||    
26390856 gtagacagttgtttgcttgtagtttttataactctcgtgtcgagttcaataggaggc 26390800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 104 - 182
Target Start/End: Original strand, 20916387 - 20916465
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctc 182  Q
    |||||||||| ||| || ||| ||  ||||||||||||| |||| |||||||||||||||||||| |||| ||||||||    
20916387 gcttgtaaattgttattagatagtagttttcagaactcttatgttgagttcaataggaggcaagcgaatgaggtcgctc 20916465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 104 - 182
Target Start/End: Original strand, 20925349 - 20925427
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctc 182  Q
    |||||||||| ||| || ||| ||  ||||||||||||| |||| |||||||||||||||||||| |||| ||||||||    
20925349 gcttgtaaattgttattagatagtagttttcagaactcttatgttgagttcaataggaggcaagcgaatgaggtcgctc 20925427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 194
Target Start/End: Complemental strand, 32073664 - 32073607
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||||| | |||||||||||| |||| ||| ||||||||||||||||    
32073664 aactctcatgtcgagtttactaggaggcaagcaaatgaggttgctcatgaattagcta 32073607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 131 - 193
Target Start/End: Complemental strand, 10346589 - 10346527
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagct 193  Q
    ||||||||||| ||||| |||||||| ||||||||||| ||| |||||||||| || ||||||    
10346589 tttcagaactcgcatgtagagttcaacaggaggcaagcgaatagggtcgctcacgagttagct 10346527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 193
Target Start/End: Complemental strand, 1017732 - 1017670
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagct 193  Q
    ||||||||||||||||| ||||||||  |||||||||| ||| |||| ||||| || ||||||    
1017732 tttcagaactctcatgttgagttcaaccggaggcaagcaaatagggtagctcacgagttagct 1017670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 130 - 184
Target Start/End: Complemental strand, 25131140 - 25131086
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcat 184  Q
    ||||| |||||||||||||||||||||||| | | |||  |||||||||||||||    
25131140 ttttctgaactctcatgtcgagttcaatagaaagtaagttaatggggtcgctcat 25131086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 131 - 220
Target Start/End: Original strand, 29237227 - 29237316
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcc 220  Q
    ||||| ||||| |||||||||| |||||| |||||||| |||| |||| ||   || ||||||  |||| |||||| |||||||||||||    
29237227 tttcaaaactcacatgtcgagtgcaatagaaggcaagctaatgaggtcacttgcgagttagctcaggtagccccatgtcatgctagctcc 29237316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 15)
Name: chr4

Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 4 - 237
Target Start/End: Complemental strand, 43989490 - 43989258
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 103  Q
43989490 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 43989391  T
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccc 203  Q
    ||||| | | | ||||||||||| |||||| ||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||    
43989390 gcttgcagacaattgttcgattg-tatttttagaacgctcatgtcgagttcaataggaggcaagccaatgaggtcgctcatgaattagttagggtagccc 43989292  T
204 catctcatgctagctcccacgtttatgatgatgt 237  Q
43989291 catctcatgctagctcccacgtttatgatgatgt 43989258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 56 - 237
Target Start/End: Complemental strand, 19316071 - 19315890
56 tttaattcaaacctaggtgatagcagtgaactaggttgtattattcaggcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttca 155  Q
    ||||| |||||  ||| |||||| ||||| |||||||| ||||| || ||||||| ||||||||| | |     ||||||||||||||||||||||||||    
19316071 tttaagtcaaatgtagatgatagtagtgagctaggttgcattatacatgcttgtagatagttgtttgttaacagttttcagaactctcatgtcgagttca 19315972  T
156 ataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttatgatgatgt 237  Q
    ||||||||||||||||||| |||| ||||||||||||   |||| ||||| || ||| ||||||||||| ||||||| ||||    
19315971 ataggaggcaagccaatggagtcgttcatgaattagcacaggtagccccaccttatggtagctcccacgcttatgattatgt 19315890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 141 - 237
Target Start/End: Complemental strand, 43813267 - 43813171
141 ctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttatgatgatgt 237  Q
    ||||||||||||||||||| || |||| ||||||||||| ||||||||||| ||||||| ||||||||||| ||||||| | ||||| |||||||||    
43813267 ctcatgtcgagttcaatagcagacaagtcaatggggtcgttcatgaattagttagggtagccccatctcatactagctctctcgtttttgatgatgt 43813171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 130 - 232
Target Start/End: Original strand, 1394129 - 1394232
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggta-accccatctcatgctagctcccacgttta 228  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||    |||  |||||||| |||||||||||||| | ||    
1394129 ttttcagaactctcatgtcgagttcaataggaggcaagctaatggggtcgttcatgaattagcacaagtagtccccatctaatgctagctcccacatcta 1394228  T
229 tgat 232  Q
1394229 tgat 1394232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 131 - 179
Target Start/End: Original strand, 9633063 - 9633111
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcg 179  Q
    |||||||||||||||||||||||||||||||||||||  ||||||||||    
9633063 tttcagaactctcatgtcgagttcaataggaggcaagtgaatggggtcg 9633111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 131 - 193
Target Start/End: Original strand, 35096913 - 35096975
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagct 193  Q
    ||||||||||||||||||||||||||||| |||||||| ||| |||| ||||| || ||||||    
35096913 tttcagaactctcatgtcgagttcaatagaaggcaagcaaatagggttgctcacgagttagct 35096975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 194
Target Start/End: Original strand, 13200849 - 13200906
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||||||| |||||||||||| |||| ||| |||||||| |||||||    
13200849 aactctcatgtcgagttcattaggaggcaagcaaatgaggttgctcatgagttagcta 13200906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 194
Target Start/End: Original strand, 47783000 - 47783057
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||||| | |||||||||||| |||| ||| ||||||||||||||||    
47783000 aactctcatgtcgagtttactaggaggcaagcaaatgaggttgctcatgaattagcta 47783057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 131 - 183
Target Start/End: Complemental strand, 1479337 - 1479285
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctca 183  Q
    ||||||||||||||| |||||||||||||||||||||  ||||||||| ||||    
1479337 tttcagaactctcatatcgagttcaataggaggcaagtaaatggggtcactca 1479285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 131 - 193
Target Start/End: Original strand, 6969614 - 6969676
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagct 193  Q
    |||||||||||||||||||| ||||||| |||| |||  |||||||||||||| || ||||||    
6969614 tttcagaactctcatgtcgatttcaataagaggtaagtaaatggggtcgctcacgagttagct 6969676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 131 - 177
Target Start/End: Complemental strand, 17283627 - 17283581
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggt 177  Q
    |||||||||||| ||||||||||||||||||||||| | ||||||||    
17283627 tttcagaactcttatgtcgagttcaataggaggcaaacgaatggggt 17283581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 129 - 174
Target Start/End: Complemental strand, 5124688 - 5124643
129 attttcagaactctcatgtcgagttcaataggaggcaagccaatgg 174  Q
    |||||||||||||| |||||||||||||| |||||||||| |||||    
5124688 attttcagaactctaatgtcgagttcaatcggaggcaagctaatgg 5124643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 36469295 - 36469374
157 taggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttatgatgatgt 237  Q
    |||||||||||| ||||||||| |  | ||||||   ||||||||||||||||| ||||||||| || |||||||||||||    
36469295 taggaggcaagctaatggggtcacg-aggaattaataagggtaaccccatctcaagctagctcctacatttatgatgatgt 36469374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 193
Target Start/End: Original strand, 16889147 - 16889209
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagct 193  Q
    ||||||||||||||||| ||||||| | |||||||||| ||| |||| ||||| || ||||||    
16889147 tttcagaactctcatgttgagttcagtcggaggcaagcaaatagggtagctcacgagttagct 16889209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 193
Target Start/End: Complemental strand, 37857076 - 37857014
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagct 193  Q
    ||||||||||||||||| |||||||| ||||||||||| ||| | || ||||| || ||||||    
37857076 tttcagaactctcatgttgagttcaacaggaggcaagcaaatagagtagctcacgagttagct 37857014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 174; Significance: 1e-93; HSPs: 9)
Name: chr6

Target: chr6; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 4 - 237
Target Start/End: Original strand, 942571 - 942804
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 103  Q
    |||||||||||||||||||||||||||||||| ||||| ||||||||||| |||||| ||||||||||||||||| ||||||||||||||||||||||||    
942571 tcattatgacaatgttgattttgttttggattccaagtctgttgttgaacattttaagtcaaacctaggtgatagtagtgaactaggttgtattattcag 942670  T
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccc 203  Q
    |||||||   |||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||  |||||    
942671 gcttgtaggcagttgttcgattgtaattttcagaactctaatgtcgagttcaataggaggcaagccaatggggtcgctcgtgaattagctaggacaaccc 942770  T
204 catctcatgctagctcccacgtttatgatgatgt 237  Q
    |||||||||||| |||||||||||| ||||||||    
942771 catctcatgctatctcccacgtttacgatgatgt 942804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 130 - 237
Target Start/End: Original strand, 4513076 - 4513183
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttat 229  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||| ||||||    
4513076 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctaatgaattagctagggtagccccatctcatactagctcccatgtttat 4513175  T
230 gatgatgt 237  Q
    ||| ||||    
4513176 gataatgt 4513183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 131 - 217
Target Start/End: Original strand, 19047092 - 19047178
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagc 217  Q
    ||||| ||||||||||||||||| |||||||||||||| |||| ||||||||| |||||||| |||||| ||| |||| || |||||    
19047092 tttcaaaactctcatgtcgagtttaataggaggcaagctaatgtggtcgctcacgaattagcgagggtagccctatctgatcctagc 19047178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 194
Target Start/End: Original strand, 15950809 - 15950866
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||||| | |||||||||||| |||| ||| ||||||||||||||||    
15950809 aactctcatgtcgagtttactaggaggcaagcaaatgaggttgctcatgaattagcta 15950866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 130 - 237
Target Start/End: Original strand, 12125820 - 12125927
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttat 229  Q
    ||||||||| ||||||||  | ||||||| ||||||||| ||||  || ||||||||||||||    ||| || ||||||||||||||| ||| || |||    
12125820 ttttcagaattctcatgttcaattcaatatgaggcaagctaatgaagtggctcatgaattagcacatgtagcctcatctcatgctagcttccatgtctat 12125919  T
230 gatgatgt 237  Q
12125920 gatgatgt 12125927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 131 - 235
Target Start/End: Complemental strand, 13757607 - 13757503
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttatg 230  Q
    ||||| ||||||||||| ||||| |||| || |||| | |||| ||||||||| |||||||||||| || | |||| | || |||||||| |  ||||||    
13757607 tttcaaaactctcatgttgagtttaataagaagcaaactaatgaggtcgctcacgaattagctaggatagctccatataatcctagctccaatttttatg 13757508  T
231 atgat 235  Q
13757507 atgat 13757503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 237
Target Start/End: Complemental strand, 20731771 - 20731689
155 aataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttatgatgatgt 237  Q
    |||||||||||||| || || |  |||||||||||||| |||||||||| || | ||||| ||| |||| |||| ||||||||    
20731771 aataggaggcaagctaacggagatgctcatgaattagcgagggtaacccaatgtgatgctcgcttccacatttaagatgatgt 20731689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 137 - 194
Target Start/End: Original strand, 21698719 - 21698776
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||||| | |||||||||||| |||| ||| |||||||  |||||||    
21698719 aactctcatgtcgagtttattaggaggcaagcaaatgaggttgctcatgttttagcta 21698776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 137 - 194
Target Start/End: Complemental strand, 30063723 - 30063666
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||||| | |||||||||||| |||| ||| |||||||  |||||||    
30063723 aactctcatgtcgagtttattaggaggcaagcaaatgaggttgctcatgttttagcta 30063666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 163; Significance: 4e-87; HSPs: 12)
Name: chr5

Target: chr5; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 43 - 237
Target Start/End: Complemental strand, 41197550 - 41197356
43 tgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcaggcttgtaaatagttgttcgattgttattttcagaactct 142  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| || | |||||||||||||| ||||||||||||||    
41197550 tgttgttgaacattttaattcaaacctaggtgatagcagtgaactaggttgtattatttaggcttatagacagttgttcgattgtaattttcagaactct 41197451  T
143 catgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttatgatgatgt 237  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
41197450 tatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtagccccatctcatgctagctcccacgtttatgatgatgt 41197356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 15 - 237
Target Start/End: Complemental strand, 36779622 - 36779403
15 atgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcaggcttgtaaata 114  Q
    ||||||||||| ||||||||| ||||| | ||||||||||||||||||||||||||  ||| || ||||||||||||||||||||| |||||||||   |    
36779622 atgttgattttattttggattccaagtctattgttgaacgttttaattcaaacctaattgagagtagtgaactaggttgtattattaaggcttgtaggca 36779523  T
115 gttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgct 214  Q
    |||||| | |||| |  ||||||||||||||||||||| ||||||||||||||||||| | ||| |||||| |||||||||||||  ||||||| ||| |    
36779522 gttgtttggttgtaa--ttcagaactctcatgtcgagtacaataggaggcaagccaatagtgtcactcatggattagctagggtagtcccatct-atgtt 36779426  T
215 agctcccacgtttatgatgatgt 237  Q
    ||||||||||| |||||||||||    
36779425 agctcccacgtctatgatgatgt 36779403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 114 - 237
Target Start/End: Complemental strand, 30376550 - 30376427
114 agttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgc 213  Q
    |||||||||||| | ||||||| |||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| || ||||||||||    
30376550 agttgttcgattataattttcaaaactcttatgtcgagttcaataggaggcaagccaatagggtcgctcatgaattagctacggtagcctcatctcatgc 30376451  T
214 tagctcccacgtttatgatgatgt 237  Q
    ||||||| ||||||||||||||||    
30376450 tagctccaacgtttatgatgatgt 30376427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 130 - 237
Target Start/End: Complemental strand, 12714954 - 12714847
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttat 229  Q
    |||||||||||||||||| | |||||| |||| |||| | |||||||||| |||| |||||||   |||||||||||| ||||||||||| || ||||||    
12714954 ttttcagaactctcatgttgggttcaaaaggaagcaacctaatggggtcgttcataaattagcagaggtaaccccatcacatgctagctctcatgtttat 12714855  T
230 gatgatgt 237  Q
12714854 gatgatgt 12714847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 130 - 237
Target Start/End: Complemental strand, 12776185 - 12776078
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttat 229  Q
    |||||||||||||||||| | |||||| |||| |||| | |||||||||| |||| |||||||   |||||||||||| ||||||||||| || ||||||    
12776185 ttttcagaactctcatgttgggttcaaaaggaagcaacctaatggggtcgttcataaattagcagaggtaaccccatcacatgctagctctcatgtttat 12776086  T
230 gatgatgt 237  Q
12776085 gatgatgt 12776078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 185 - 237
Target Start/End: Complemental strand, 12378660 - 12378608
185 gaattagctagggtaaccccatctcatgctagctcccacgtttatgatgatgt 237  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||    
12378660 gaattagctagggtagccccatctcatgctagctcccacgtttatgatgatgt 12378608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 80 - 236
Target Start/End: Original strand, 34905529 - 34905685
80 agtgaactaggttgtattattcaggcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcg 179  Q
    ||||| ||||||||| |||| || ||||||| | ||||||| | |  |  |||||||||||||  ||| |||||||||||||| ||| |||||| |||||    
34905529 agtgagctaggttgtgttatacatgcttgtagacagttgtttgttaatagttttcagaactcttgtgttgagttcaataggagacaaaccaatgaggtcg 34905628  T
180 ctcatgaattagctagggtaaccccatctcatgctagctcccacgtttatgatgatg 236  Q
    |||||||||||||    ||| ||| ||||||||||| |||||| ||||| |||||||    
34905629 ctcatgaattagcccaagtagcccgatctcatgctaactcccaagtttacgatgatg 34905685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 130 - 183
Target Start/End: Original strand, 34525 - 34578
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctca 183  Q
    |||||||||||||||||||||||| ||||||| ||||||||||  |||||||||    
34525 ttttcagaactctcatgtcgagtttaataggaagcaagccaatatggtcgctca 34578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 131 - 207
Target Start/End: Complemental strand, 14857028 - 14856952
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatc 207  Q
    ||||| ||||||||||||||||| |||| ||||||| | |||| | |||||||||||||||||| || | |||||||    
14857028 tttcaaaactctcatgtcgagtttaatatgaggcaaacaaatgtgatcgctcatgaattagctaaggcatccccatc 14856952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 133 - 228
Target Start/End: Original strand, 29985435 - 29985530
133 tcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgttta 228  Q
    ||||||||||||||||||||||||||| || ||||| |||| ||||| ||| || ||||||  |||| ||| |  ||||| |||||||||| ||||    
29985435 tcagaactctcatgtcgagttcaatagaagacaagctaatgaggtcgttcacgagttagctcaggtagccctaggtcatgttagctcccacattta 29985530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 137 - 194
Target Start/End: Complemental strand, 19609213 - 19609156
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||||| | |||||||||||| |||| ||| |||||||  |||||||    
19609213 aactctcatgtcgagtttattaggaggcaagcaaatgaggttgctcatgttttagcta 19609156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 176 - 237
Target Start/End: Original strand, 39714874 - 39714935
176 gtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttatgatgatgt 237  Q
    |||||||||||||||| ||| ||| ||||| || ||  |||||| |||||||||||||||||    
39714874 gtcgctcatgaattagttagtgtagccccaccttatattagctctcacgtttatgatgatgt 39714935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 12)
Name: chr7

Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 4 - 237
Target Start/End: Original strand, 23820401 - 23820634
4 tcattatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcag 103  Q
    |||||||||| ||||| ||||||||||||||| ||||| |||||||| ||  ||||||||||||||||||||||| ||||||||||||||||| ||||||    
23820401 tcattatgaccatgttaattttgttttggattccaagtctgttgttgtacactttaattcaaacctaggtgatagtagtgaactaggttgtatcattcag 23820500  T
104 gcttgtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccc 203  Q
    | |||||   ||||||| |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||   |    
23820501 gtttgtaggcagttgtttgattgtaattttcagaactctcatatcgagttcaataggaggcaagccaatggggtcgctcatgaattagatagggtagatc 23820600  T
204 catctcatgctagctcccacgtttatgatgatgt 237  Q
    |||||||||||||||||||| |||||||||||||    
23820601 catctcatgctagctcccacatttatgatgatgt 23820634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 8 - 237
Target Start/End: Complemental strand, 24808980 - 24808771
8 tatgacaatgttgattttgttttggattgcaagtttgttgttgaacgttttaattcaaacctaggtgatagcagtgaactaggttgtattattcaggctt 107  Q
    |||||| |||||||||||||||| |||| ||||| ||||||||| ||||||||||||||||||| |||||| ||||||||||||||||||||||||||||    
24808980 tatgaccatgttgattttgttttagattccaagtctgttgttgatcgttttaattcaaacctagttgatagtagtgaactaggttgtattattcaggctt 24808881  T
108 gtaaatagttgttcgattgttattttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatc 207  Q
    |||   ||||||| | ||||         |||        | ||||||||||||||||||||||||||| | ||||||||||||||||| || |||||||    
24808880 gtaggcagttgtttggttgt---------aac--------ctagttcaataggaggcaagccaatggggccactcatgaattagctaggatagccccatc 24808798  T
208 tcatgctagctcccacgtttatgatgatgt 237  Q
    |||||||||   ||||||||||||||||||    
24808797 tcatgctag---ccacgtttatgatgatgt 24808771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 130 - 237
Target Start/End: Original strand, 21118399 - 21118505
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttat 229  Q
    ||||||||||||||||||||||||||||||||||||||| |||| |||| ||||||  |||||||||||| | ||||||  |||||||||| ||||||||    
21118399 ttttcagaactctcatgtcgagttcaataggaggcaagctaatgaggtcactcatg-gttagctagggtagcaccatctattgctagctccaacgtttat 21118497  T
230 gatgatgt 237  Q
    ||| ||||    
21118498 gataatgt 21118505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 134 - 239
Target Start/End: Complemental strand, 40901908 - 40901803
134 cagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttatgatg 233  Q
    |||||||||||||||||||| |||||||||||| | |||  |||||||||||||||| |   |||| | ||||||||||||||||||||  | |||||||    
40901908 cagaactctcatgtcgagttgaataggaggcaaactaatatggtcgctcatgaattaacacaggtagctccatctcatgctagctcccatatctatgatg 40901809  T
234 atgtcc 239  Q
40901808 atgtcc 40901803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 131 - 183
Target Start/End: Original strand, 12980735 - 12980787
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctca 183  Q
    |||||||||||||||||||||||||| ||||||||| | ||||||||||||||    
12980735 tttcagaactctcatgtcgagttcaacaggaggcaaacgaatggggtcgctca 12980787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 135 - 193
Target Start/End: Original strand, 20492489 - 20492547
135 agaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagct 193  Q
    ||||||||||| ||||||| |||||||||||||| ||| |||||||||| |||||||||    
20492489 agaactctcatctcgagtttaataggaggcaagcgaatagggtcgctcacgaattagct 20492547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 194
Target Start/End: Original strand, 29526837 - 29526894
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||||| | |||||||||||| |||| ||| ||||||||||||||||    
29526837 aactctcatgtcgagtttactaggaggcaagcaaatgaggttgctcatgaattagcta 29526894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 137 - 193
Target Start/End: Complemental strand, 10325166 - 10325110
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagct 193  Q
    ||||||||||||||||| |||||||||||| | |||| |||||||||||| ||||||    
10325166 aactctcatgtcgagtttaataggaggcaaacgaatgaggtcgctcatgagttagct 10325110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 130 - 180
Target Start/End: Complemental strand, 31957100 - 31957050
130 ttttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgc 180  Q
    ||||||||||| ||||||||| ||||||||||||||||  |||||| ||||    
31957100 ttttcagaactatcatgtcgaattcaataggaggcaagttaatgggatcgc 31957050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 137 - 194
Target Start/End: Complemental strand, 665047 - 664990
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||||| | |||||| ||||| |||| ||| || |||||||||||||    
665047 aactctcatgtcgagtttattaggagacaagcaaatgaggttgcacatgaattagcta 664990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 137 - 194
Target Start/End: Complemental strand, 21588208 - 21588151
137 aactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagcta 194  Q
    ||||||||||||||||| | |||||||||| | |||| ||| || |||||||||||||    
21588208 aactctcatgtcgagtttattaggaggcaatcaaatgaggttgcacatgaattagcta 21588151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 131 - 191
Target Start/End: Complemental strand, 8321252 - 8321192
131 tttcagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattag 191  Q
    ||||| |||||||||||||| || |||| ||| ||| | || |||||||||||||||||||    
8321252 tttcaaaactctcatgtcgaatttaatacgagacaaacaaacggggtcgctcatgaattag 8321192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: scaffold0041

Target: scaffold0041; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 134 - 239
Target Start/End: Original strand, 48110 - 48215
134 cagaactctcatgtcgagttcaataggaggcaagccaatggggtcgctcatgaattagctagggtaaccccatctcatgctagctcccacgtttatgatg 233  Q
    |||||||||||||||||||| |||||||||||| | |||  |||||||||||||||| |   |||| | ||||||||||||||||||||  | |||||||    
48110 cagaactctcatgtcgagttgaataggaggcaaactaatatggtcgctcatgaattaacacaggtagctccatctcatgctagctcccatatctatgatg 48209  T
234 atgtcc 239  Q
48210 atgtcc 48215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 216842 times since January 2019
Visitors: 2908