View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_low_65 (Length: 252)

Name: NF0945_low_65
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0945_low_65
NF0945_low_65
[»] chr2 (2 HSPs)
chr2 (11-252)||(6953939-6954180)
chr2 (13-225)||(6963492-6963709)
[»] chr4 (3 HSPs)
chr4 (100-179)||(18134631-18134710)
chr4 (100-179)||(49121840-49121919)
chr4 (124-203)||(49105241-49105320)


Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 11 - 252
Target Start/End: Original strand, 6953939 - 6954180
Alignment:
11 cacagataatgttttcaatgaggttttggatgctagcttttgtgttgatcatatcagaaatttttggagcttctttgaatatagttgaaggaaagcctca 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6953939 cacagataatgttttcaatgaggttttggatgctagcttttgtgttgatcatatcagaaatttttggagcttctttgaatatagttgaaggaaagcctca 6954038  T
111 aaggattcttttggatacagatgttgatactgatgatttatttgcacttctatatcttttgaagctcaatagatcagagtttctattagaggttagcaaa 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6954039 aaggattcttttggatacagatgttgatactgatgatttatttgcacttctatatcttttgaagctcaatagatcagagtttctattagaggttagcaaa 6954138  T
211 actaaccaaattgaaaaagtttccttaattcactttttcttt 252  Q
    ||||||||||||||||||||||||||||||||||||||||||    
6954139 actaaccaaattgaaaaagtttccttaattcactttttcttt 6954180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 13 - 225
Target Start/End: Original strand, 6963492 - 6963709
Alignment:
13 cagataatgttttcaatgaggttttggatgctagcttttgtgttgatc-----atatcagaaatttttggagcttctttgaatatagttgaaggaaagcc 107  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||||||||||||||||||||    
6963492 cagagaatgttttcaatgaggttttggatgctagcttttgtgttgatcagatcatatcagaaatttttggagcttctttgaatatagttgaaggaaagcc 6963591  T
108 tcaaaggattcttttggatacagatgttgatactgatgatttatttgcacttctatatcttttgaagctcaatagatcagagtttctattagaggttagc 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| ||| |||| |||||||||||||    
6963592 tcaaaggattcttttggatacagatgttgatactgatgatttatttgcattgctatatcttttgaagctcaatagattagaatttcaattagaggttagc 6963691  T
208 aaaactaaccaaattgaa 225  Q
    ||||| ||||||||||||    
6963692 aaaacaaaccaaattgaa 6963709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 100 - 179
Target Start/End: Complemental strand, 18134710 - 18134631
Alignment:
100 ggaaagcctcaaaggattcttttggatacagatgttgatactgatgatttatttgcacttctatatcttttgaagctcaa 179  Q
    |||||||||||| | ||| || ||||||| |||||||||||||||||||||||||| || || |||||| | ||||||||    
18134710 ggaaagcctcaacgaattgttgtggatactgatgttgatactgatgatttatttgctctgctttatcttcttaagctcaa 18134631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 100 - 179
Target Start/End: Complemental strand, 49121919 - 49121840
Alignment:
100 ggaaagcctcaaaggattcttttggatacagatgttgatactgatgatttatttgcacttctatatcttttgaagctcaa 179  Q
    |||||||||||| | ||| || ||||||| |||||||||||||||||||||||||| || || |||||| | ||||||||    
49121919 ggaaagcctcaacgaattgttgtggatactgatgttgatactgatgatttatttgctctgctttatcttcttaagctcaa 49121840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 203
Target Start/End: Complemental strand, 49105320 - 49105241
Alignment:
124 gatacagatgttgatactgatgatttatttgcacttctatatcttttgaagctcaatagatcagagtttctattagaggt 203  Q
    ||||||||||||| ||| || ||||||||||| || || || ||| | ||||||||||  |||||||||| |||||||||    
49105320 gatacagatgttgctaccgacgatttatttgctctactctaccttctcaagctcaatacttcagagtttcaattagaggt 49105241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 216674 times since January 2019
Visitors: 2908