View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_low_71 (Length: 251)

Name: NF0945_low_71
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0945_low_71
NF0945_low_71
[»] chr6 (8 HSPs)
chr6 (1-245)||(11739727-11739971)
chr6 (1-227)||(12093973-12094199)
chr6 (1-227)||(11755736-11755962)
chr6 (1-136)||(11632001-11632136)
chr6 (5-145)||(11710537-11710677)
chr6 (1-136)||(11618096-11618231)
chr6 (4-135)||(11674023-11674154)
chr6 (1-145)||(11662912-11663056)
[»] chr1 (1 HSPs)
chr1 (7-144)||(44811503-44811640)
[»] scaffold0019 (1 HSPs)
scaffold0019 (43-136)||(8950-9043)
[»] scaffold0196 (1 HSPs)
scaffold0196 (44-134)||(12491-12581)


Alignment Details
Target: chr6 (Bit Score: 237; Significance: 1e-131; HSPs: 8)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 11739971 - 11739727
Alignment:
1 ccactagcaaagttacaacataagtatctaagcaaacttctcgtggcacaagatgaaaggttaaaggctagttccgaggctctagtgaatgtgaaagtgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11739971 ccactagcaaagttacaacataagtatctaagcaaacttctcgtggcacaagatgaaaggttaaaggctagttccgaggctctagtgaatgtgaaagtgt 11739872  T
101 tgaagttatatgcatgggaaacccattttaaaaatgctatagaaagcctaagattttccgaactcaaattcttatcttcagtgctactgcaaaaagcata 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
11739871 tgaagttatatgcatgggaaacccattttaaaaatgctatagaaagcctcagattttccgaactcaaattcttatcttcagtgctactgcaaaaagcata 11739772  T
201 caatgtcattctcttctggttttcaccgttttttatctctgctgc 245  Q
    ||||||||||||||||||||||||||||||||| |||||||||||    
11739771 caatgtcattctcttctggttttcaccgtttttgatctctgctgc 11739727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 12094199 - 12093973
Alignment:
1 ccactagcaaagttacaacataagtatctaagcaaacttctcgtggcacaagatgaaaggttaaaggctagttccgaggctctagtgaatgtgaaagtgt 100  Q
    ||||||||||||||||||||||||||||| || |||||||| ||||| |||||||||||||| ||||||||||| |||||||| |||||| ||||||||     
12094199 ccactagcaaagttacaacataagtatcttagtaaacttctggtggcccaagatgaaaggttgaaggctagttctgaggctctggtgaatatgaaagtgc 12094100  T
101 tgaagttatatgcatgggaaacccattttaaaaatgctatagaaagcctaagattttccgaactcaaattcttatcttcagtgctactgcaaaaagcata 200  Q
    | |||||||||||||||||||  |||||||||||| | || |||| ||||||| ||   ||||  ||||| |||||||||||| || | ||||| |||||    
12094099 taaagttatatgcatgggaaatgcattttaaaaattccattgaaatcctaagaattgttgaacaaaaattgttatcttcagtgttattacaaaaggcata 12094000  T
201 caatgtcattctcttctggttttcacc 227  Q
    ||   | |||||||| |||||||||||    
12093999 cagccttattctcttttggttttcacc 12093973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 11755736 - 11755962
Alignment:
1 ccactagcaaagttacaacataagtatctaagcaaacttctcgtggcacaagatgaaaggttaaaggctagttccgaggctctagtgaatgtgaaagtgt 100  Q
    |||||||||||||||||||||||||||||||| |||||||| ||||| |||||||||||||| || |||||||| |||||||| |||||  ||||||||     
11755736 ccactagcaaagttacaacataagtatctaagtaaacttctggtggcccaagatgaaaggttgaaagctagttctgaggctctggtgaacatgaaagtgc 11755835  T
101 tgaagttatatgcatgggaaacccattttaaaaatgctatagaaagcctaagattttccgaactcaaattcttatcttcagtgctactgcaaaaagcata 200  Q
    | |||||||||||||||||||  |||||||||||| | || |||| ||||||| ||   |||   ||||| ||||||||||||||| | ||||| |||||    
11755836 taaagttatatgcatgggaaatgcattttaaaaattccattgaaatcctaagaattgttgaagaaaaattgttatcttcagtgctattacaaaaggcata 11755935  T
201 caatgtcattctcttctggttttcacc 227  Q
    ||   | || ||||| |||||||||||    
11755936 cagccttatgctcttttggttttcacc 11755962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 11632136 - 11632001
Alignment:
1 ccactagcaaagttacaacataagtatctaagcaaacttctcgtggcacaagatgaaaggttaaaggctagttccgaggctctagtgaatgtgaaagtgt 100  Q
    |||||||||||||||||||| |||||||  ||||||||| | |||||||||||||| || |||||||||||||| |||||||| |||||| |||||||||    
11632136 ccactagcaaagttacaacacaagtatcagagcaaacttatggtggcacaagatgagagattaaaggctagttcggaggctcttgtgaatatgaaagtgt 11632037  T
101 tgaagttatatgcatgggaaacccattttaaaaatg 136  Q
    ||||||| ||||| |||||||  |||||||||||||    
11632036 tgaagttgtatgcgtgggaaaatcattttaaaaatg 11632001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 5 - 145
Target Start/End: Complemental strand, 11710677 - 11710537
Alignment:
5 tagcaaagttacaacataagtatctaagcaaacttctcgtggcacaagatgaaaggttaaaggctagttccgaggctctagtgaatgtgaaagtgttgaa 104  Q
    |||||||||||||| | |||| ||  ||| ||||| | ||||||||||| || || || |||||||||||||||||||| |||||| |||||||| | ||    
11710677 tagcaaagttacaaaacaagtttcagagcgaacttatggtggcacaagacgagagattgaaggctagttccgaggctcttgtgaatatgaaagtgctcaa 11710578  T
105 gttatatgcatgggaaacccattttaaaaatgctatagaaa 145  Q
    ||||||||||||||||| |||||||||||||||||||||||    
11710577 gttatatgcatgggaaaaccattttaaaaatgctatagaaa 11710537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 11618096 - 11618231
Alignment:
1 ccactagcaaagttacaacataagtatctaagcaaacttctcgtggcacaagatgaaaggttaaaggctagttccgaggctctagtgaatgtgaaagtgt 100  Q
    ||||||||||| |||||||| |||| || || | ||||| | ||||| |||||||| || |||||||| ||||| |||||||| |||||| |||||||||    
11618096 ccactagcaaacttacaacacaagtttcaaacccaacttatggtggcgcaagatgagagattaaaggcgagttcggaggctcttgtgaatatgaaagtgt 11618195  T
101 tgaagttatatgcatgggaaacccattttaaaaatg 136  Q
    ||||| |||||||||||||||| |||||||||||||    
11618196 tgaagctatatgcatgggaaacacattttaaaaatg 11618231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 4 - 135
Target Start/End: Complemental strand, 11674154 - 11674023
Alignment:
4 ctagcaaagttacaacataagtatctaagcaaacttctcgtggcacaagatgaaaggttaaaggctagttccgaggctctagtgaatgtgaaagtgttga 103  Q
    ||||||||| ||||||| |||| ||  ||||||||  | ||||| |||||||| || ||||| || ||||| |||||||| |||||| ||||||||||||    
11674154 ctagcaaagctacaacacaagtttcagagcaaactaatggtggcgcaagatgagagattaaaagcgagttctgaggctcttgtgaatatgaaagtgttga 11674055  T
104 agttatatgcatgggaaacccattttaaaaat 135  Q
    || |||||||||||||||||||||||||||||    
11674054 agctatatgcatgggaaacccattttaaaaat 11674023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 145
Target Start/End: Original strand, 11662912 - 11663056
Alignment:
1 ccactagcaaagttacaacataagtatctaagcaaacttctcgtggcacaagatgaaaggttaaaggctagttccgaggctctagtgaatgtgaaagtgt 100  Q
    |||||||||||||| ||||| |||| ||  ||  ||||| | ||||||||||| || || || ||||||||||| |||||||| |||| | ||||||||     
11662912 ccactagcaaagttgcaacacaagtttcagagtgaacttatggtggcacaagacgagagattgaaggctagttctgaggctcttgtgagtatgaaagtgc 11663011  T
101 tgaagttatatgcatgggaaacccattttaaaaatgctatagaaa 145  Q
    | ||| |||||||||||||||| |||||||||| | |||||||||    
11663012 taaagctatatgcatgggaaacacattttaaaagttctatagaaa 11663056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 7 - 144
Target Start/End: Original strand, 44811503 - 44811640
Alignment:
7 gcaaagttacaacataagtatctaagcaaacttctcgtggcacaagatgaaaggttaaaggctagttccgaggctctagtgaatgtgaaagtgttgaagt 106  Q
    |||||||||||||| |||| || |||||||||| | || ||||||||||| || || ||||||| ||| |||||||| |||||| |||| ||| ||||||    
44811503 gcaaagttacaacacaagtttcaaagcaaacttatggtagcacaagatgagagattgaaggctacttctgaggctcttgtgaatatgaaggtgctgaagt 44811602  T
107 tatatgcatgggaaacccattttaaaaatgctatagaa 144  Q
    |||||||||||||||||   ||||||||| ||||||||    
44811603 tatatgcatgggaaaccagctttaaaaattctatagaa 44811640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0019 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: scaffold0019
Description:

Target: scaffold0019; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 43 - 136
Target Start/End: Complemental strand, 9043 - 8950
Alignment:
43 gtggcacaagatgaaaggttaaaggctagttccgaggctctagtgaatgtgaaagtgttgaagttatatgcatgggaaacccattttaaaaatg 136  Q
    |||||||||||||| || |||||||||||||  ||| || | || | | ||||||||||||||||||||||||||||||| |||||||||||||    
9043 gtggcacaagatgagagattaaaggctagttttgagtcttttgttactatgaaagtgttgaagttatatgcatgggaaacacattttaaaaatg 8950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0196 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0196
Description:

Target: scaffold0196; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 44 - 134
Target Start/End: Original strand, 12491 - 12581
Alignment:
44 tggcacaagatgaaaggttaaaggctagttccgaggctctagtgaatgtgaaagtgttgaagttatatgcatgggaaacccattttaaaaa 134  Q
    |||||||||| || || ||||||| |||||| || |||||   |||| |||||||||||||  ||||||||||||||| ||||||||||||    
12491 tggcacaagacgagagattaaaggttagttctgaagctctcacgaatatgaaagtgttgaaactatatgcatgggaaaaccattttaaaaa 12581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 217237 times since January 2019
Visitors: 2908