View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_low_72 (Length: 251)

Name: NF0945_low_72
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0945_low_72
[»] chr2 (1 HSPs)
chr2 (8-251)||(5566359-5566602)

Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 8 - 251
Target Start/End: Complemental strand, 5566602 - 5566359
8 cgaagaatatcatcgcatcacttgtgtatgatagtacttctaatccagaggtaacctatccaacggatatcaaacgtcttgctcaactcgttatataaat 107  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5566602 cgaacaatatcatcgcatcacttgtgtatgatagtacttctaatccagaggtaacctatccaacggatatcaaacgtcttgctcaactcgttatataaat 5566503  T
108 aagttcaagtcataggcatgaccttaaataagctcaatttatttgcataatagaacgataagttcaacttattacgtgtaagcaataagcaatcataaat 207  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5566502 aagttcaagttataggcatgaccttaaataagctcaatttatttgcataatagaacgataagttcaacttattacgtgtaagcaataagcaatcataaat 5566403  T
208 tgagtagaataaattaggattgatgtgtcataatccgtaatatt 251  Q
5566402 tgagtagaataaattaggattgatgtgtcataatccgtaatatt 5566359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 176098 times since January 2019
Visitors: 2680