View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_low_73 (Length: 251)

Name: NF0945_low_73
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0945_low_73
NF0945_low_73
[»] chr2 (1 HSPs)
chr2 (8-251)||(5566359-5566602)


Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 8 - 251
Target Start/End: Complemental strand, 5566602 - 5566359
Alignment:
8 cgaacaatatcatcgcatcacttgtgtatgatagtacttctaatccagaggtaacctatccaacggatatcaaacgtcttgctcaactcgttatataaat 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5566602 cgaacaatatcatcgcatcacttgtgtatgatagtacttctaatccagaggtaacctatccaacggatatcaaacgtcttgctcaactcgttatataaat 5566503  T
108 aagttcaagtcataggcatgaccttaaataagctcaatttatttgcataatagaacgataagttcaacttattacgtgtaagcaataagcaatcataaat 207  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5566502 aagttcaagttataggcatgaccttaaataagctcaatttatttgcataatagaacgataagttcaacttattacgtgtaagcaataagcaatcataaat 5566403  T
208 tgagtagaataaattaggattgatgtgtcataatccgtaatatt 251  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
5566402 tgagtagaataaattaggattgatgtgtcataatccgtaatatt 5566359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 115978 times since January 2019
Visitors: 1394