View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_low_77 (Length: 246)

Name: NF0945_low_77
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0945_low_77
NF0945_low_77
[»] chr2 (1 HSPs)
chr2 (3-234)||(39298724-39298955)


Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 3 - 234
Target Start/End: Original strand, 39298724 - 39298955
Alignment:
3 tcacgccatgattcatctttcttcttagcagtaaactccttagcagtctcgccagcagaagcagccaaacctttcacaacatccaccgatttcgacgcaa 102  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||    
39298724 tcacgccatgattcatctttcttcttagcagtaaactccttagcagtctcaccagcagaagcagccaaacctttcacaacatccaccgatttcaacgcaa 39298823  T
103 gctcggccgcctttggtacaacatatccagccgctccttcaacagcatgcgctgcagccttagttccatccacggtcaacttcgtcgaataatgtgccgc 202  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39298824 gcccggccgcctttggtacaacatatccagccgctccttcaacagcatgcgctgcagccttagttccatccacggtcaacttcgtcgaataatgtgccgc 39298923  T
203 agtccaccctgccacggtggccttatccttca 234  Q
    ||||||||||||||||||||||||||||||||    
39298924 agtccaccctgccacggtggccttatccttca 39298955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 17990 times since January 2019
Visitors: 1567