View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0961_high_26 (Length: 321)

Name: NF0961_high_26
Description: NF0961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0961_high_26
NF0961_high_26
[»] chr1 (1 HSPs)
chr1 (13-310)||(47875815-47876112)


Alignment Details
Target: chr1 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 13 - 310
Target Start/End: Complemental strand, 47876112 - 47875815
Alignment:
13 acttccttttggcggtaagcatggcgatatgaacagtcactttctagttttctcaagttacccccctctccgctcgttgaagaccgcacagtgctgcttc 112  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
47876112 acttccttttggcggtaagcatagcgatatgaacggtcactttctagttttctcaagttacccccctctccgctcgttgaagaccgcacagtgctgcttg 47876013  T
113 nnnnnnnnttacggggcacgacttaactgatcattctgtctctcccacttggaggttgaattatatctttccatcattctgacttacagctactccttac 212  Q
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
47876012 aaaaaaatttacggggcacgacttaactgatcattctgtctctcccacttggaggttgaattatatctttccatcattctgacttacaactactccttac 47875913  T
213 agaagtccttgcaatgcagtaatatgcagtattcatttcaaactgatagtcttctgccccaaatccatgatagtcttctacggccaaaattaagtata 310  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47875912 agaagtccttgcaatgcagtaatatgcagtattcatttcaaactgatagtcttctgccccaaatccatgatagtcttctacggccaaaattaagtata 47875815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 116102 times since January 2019
Visitors: 1394