View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0961_high_30 (Length: 252)

Name: NF0961_high_30
Description: NF0961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0961_high_30
NF0961_high_30
[»] chr1 (1 HSPs)
chr1 (1-239)||(36513480-36513718)


Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 36513718 - 36513480
Alignment:
1 tattttccctttttatttgatgctatgattgacacattgaatgagaataagcgtgtgaatcgtgaagttagtgaaagaaaatgtagaaattgtgaataaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||    
36513718 tattttccctttttatttgatgctatgattgacacattgaatgagaataagcgtgtgaatcgtgaagttagtgaaacaaaatgtaaaaattgtgaataaa 36513619  T
101 aatataaatttatggtaaaacgcatttttcaattttgaagtgaagaagagcatgtagtatctcaagggaaagcgacctatatgattgtactgccttttta 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
36513618 aatataaatttatggtaaaacgcatttttcaattttgaagtgaagaagagcatgtagtatctcaagggaaagtgacctatatgattgtactgccttttta 36513519  T
201 ccgacagttagccgacccggttttctttgcttactcttc 239  Q
    |||||||||||||||||||||||||||||||||||||||    
36513518 ccgacagttagccgacccggttttctttgcttactcttc 36513480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 37879 times since January 2019
Visitors: 1597