View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0961_low_22 (Length: 365)

Name: NF0961_low_22
Description: NF0961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0961_low_22
NF0961_low_22
[»] chr5 (1 HSPs)
chr5 (2-336)||(33827951-33828285)


Alignment Details
Target: chr5 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 2 - 336
Target Start/End: Original strand, 33827951 - 33828285
Alignment:
2 gtgtagtatcataggccatacaatcaatacagtaagaaactctttctgggaaaacggtttcgatatcatatgcgacagatgaacagcttccactgtaatg 101  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33827951 gtgtagtattataggccatacaatcaatacagtaagaaactctttctgggaaaacggtttcgatatcatatgcgacagatgaacagcttccactgtaatg 33828050  T
102 atgataatgcgtgattttggaattggaagtgagattttaatgctgcaatgataaattttacacggtgcaagaagtcagtaatgatgtagttttgaaatca 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33828051 atgataatgcgtgattttggaattggaagtgagattttaatgctgcaatgataaattttacacggtgcaagaagtcagtaatgatgtagttttgaaatca 33828150  T
202 tccggtaatggctgaaaagttattaaaacaattatagttaatatgagaggaattatttgattaagttggtgatataacttaaacaggtttatggttaaaa 301  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33828151 tccggtaatggctgaaaaattattaaaacaattatagttaatatgagaggaattatttgattaagttggtgatataacttaaacaggtttatggttaaaa 33828250  T
302 agaaattaaaaacttatgtatatcttaatgaaaaa 336  Q
    ||||||||||||||||||||| |||||| ||||||    
33828251 agaaattaaaaacttatgtatgtcttaacgaaaaa 33828285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 115682 times since January 2019
Visitors: 1394