View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0961_low_33 (Length: 271)

Name: NF0961_low_33
Description: NF0961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0961_low_33
NF0961_low_33
[»] chr4 (1 HSPs)
chr4 (1-258)||(52751022-52751279)


Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 52751022 - 52751279
Alignment:
1 aatctaggaaaagttgaactagcttcagcattgtcattcaacaaacaggttttccatcgaaaactcgctagacaaatcaaaacttcatgcaaccaacaga 100  Q
    ||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
52751022 aatctagaaaaagttgaactagcttcagcattgtcattcaacaaacgggttttccatcgaaaactcgctagacaaatcaaaacttcatgcaaccaacaga 52751121  T
101 gtgacctatttatagcttgtctatgaaaacataaatcttgcaatgctaaatacactaaacaaataatcaataatgacattttttatgcatgcatttaata 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52751122 gtgacctatttatagcttgtctatgaaaacataaatcttgcaatgctaaatacactaaacaaataatcaataatgacattttttatgcatgcatttaata 52751221  T
201 caactgcaaatattggaaataaaattgtttcactacagatatgaaataacagaccttc 258  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
52751222 caactgcaaatattggaaataaaattgtttcactacggatatgaaataacagaccttc 52751279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 109679 times since January 2019
Visitors: 1349