View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0961_low_36 (Length: 252)

Name: NF0961_low_36
Description: NF0961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0961_low_36
[»] chr1 (1 HSPs)
chr1 (1-239)||(36513480-36513718)

Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 36513718 - 36513480
1 tattttccctttttatttgatgctatgattgacacattgaatgagaataagcgtgtgaatcgtgaagttagtgaaagaaaatgtagaaattgtgaataaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||    
36513718 tattttccctttttatttgatgctatgattgacacattgaatgagaataagcgtgtgaatcgtgaagttagtgaaacaaaatgtaaaaattgtgaataaa 36513619  T
101 aatataaatttatggtaaaacgcatttttcaattttgaagtgaagaagagcatgtagtatctcaagggaaagcgacctatatgattgtactgccttttta 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
36513618 aatataaatttatggtaaaacgcatttttcaattttgaagtgaagaagagcatgtagtatctcaagggaaagtgacctatatgattgtactgccttttta 36513519  T
201 ccgacagttagccgacccggttttctttgcttactcttc 239  Q
36513518 ccgacagttagccgacccggttttctttgcttactcttc 36513480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 116117 times since January 2019
Visitors: 1395