View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0961_low_44 (Length: 230)

Name: NF0961_low_44
Description: NF0961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0961_low_44
NF0961_low_44
[»] chr2 (5 HSPs)
chr2 (1-218)||(34029560-34029777)
chr2 (1-218)||(34031495-34031712)
chr2 (1-218)||(34026632-34026849)
chr2 (125-193)||(34034675-34034743)
chr2 (150-195)||(38019382-38019427)


Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 34029777 - 34029560
Alignment:
1 taaaagaccaacttggtgtttgcgggtggaactatgcttttaggtcaattcatcaacatgctaagaacaatattagatcatacactcaggctaagaaatt 100  Q
    ||||||||||||||||||| ||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
34029777 taaaagaccaacttggtgtatgcaggtggaactatgcttttaggtcacttcatcaacatgctaagaacaatattagatcatacactcaggctaagaaatt 34029678  T
101 gtcatctgcttcttctgctgctgtttccaacaaggtgaaaagaaccaaggaagaatctatgaagaaagtcatggacttgaattgttggggtcctagtact 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34029677 gtcatctgcttcttctgctgctgtttccaacaaggtgaaaagaaccaaggaagaatctatgaagaaagtcatggacttgaattgttggggtcctagtact 34029578  T
201 gcaaggttttaatattgt 218  Q
    ||||||||||||||||||    
34029577 gcaaggttttaatattgt 34029560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 34031712 - 34031495
Alignment:
1 taaaagaccaacttggtgtttgcgggtggaactatgcttttaggtcaattcatcaacatgctaagaacaatattagatcatacactcaggctaagaaatt 100  Q
    ||||||||||||||||||| ||| ||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |||| || ||||||||    
34031712 taaaagaccaacttggtgtatgcaggtggaactatgcttttagatcacttcatcaacatgctaagaacaatattagatcatactctcaagccaagaaatt 34031613  T
101 gtcatctgcttcttctgctgctgtttccaacaaggtgaaaagaaccaaggaagaatctatgaagaaagtcatggacttgaattgttggggtcctagtact 200  Q
    ||| |||||||| |||||||||||||| || |||||||| |||| ||||||||||||||||| ||||||||| ||||||||||| |||||||||||||||    
34031612 gtcctctgcttcatctgctgctgtttcgaataaggtgaagagaagcaaggaagaatctatgaggaaagtcattgacttgaattgctggggtcctagtact 34031513  T
201 gcaaggttttaatattgt 218  Q
    ||||||||||||||||||    
34031512 gcaaggttttaatattgt 34031495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 34026849 - 34026632
Alignment:
1 taaaagaccaacttggtgtttgcgggtggaactatgcttttaggtcaattcatcaacatgctaagaacaatattagatcatacactcaggctaagaaatt 100  Q
    ||||||||||||||||||| ||| |||||||| || ||||||| ||  ||||||| |||||||||| |||||| |||||||||||| |||| ||||||||    
34026849 taaaagaccaacttggtgtatgcaggtggaaccattcttttagatcctttcatcagcatgctaagagcaatatcagatcatacactaaggccaagaaatt 34026750  T
101 gtcatctgcttcttctgctgctgtttccaacaaggtgaaaagaaccaaggaagaatctatgaagaaagtcatggacttgaattgttggggtcctagtact 200  Q
    ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||| |||||||||||| ||||||||||||||    
34026749 gtcatctgcttcttctgctgctgtttccaacaaggtgaagagaagcaaggaagaatctatgaggaaagtcattgacttgaattgtcggggtcctagtact 34026650  T
201 gcaaggttttaatattgt 218  Q
     |||||||||||||||||    
34026649 tcaaggttttaatattgt 34026632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 125 - 193
Target Start/End: Complemental strand, 34034743 - 34034675
Alignment:
125 ttccaacaaggtgaaaagaaccaaggaagaatctatgaagaaagtcatggacttgaattgttggggtcc 193  Q
    ||||||||||| ||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
34034743 ttccaacaaggggaagagaaacaaggaagaatctatgaagaaagtcatggacctgaattgttggggtcc 34034675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 150 - 195
Target Start/End: Original strand, 38019382 - 38019427
Alignment:
150 gaagaatctatgaagaaagtcatggacttgaattgttggggtccta 195  Q
    ||||||||| ||| |||||||||| |||||| ||||||||||||||    
38019382 gaagaatctttgaggaaagtcatgtacttgagttgttggggtccta 38019427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 191819 times since January 2019
Visitors: 2831