View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0961_low_44 (Length: 230)

Name: NF0961_low_44
Description: NF0961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0961_low_44
[»] chr2 (5 HSPs)
chr2 (1-218)||(34029560-34029777)
chr2 (1-218)||(34031495-34031712)
chr2 (1-218)||(34026632-34026849)
chr2 (125-193)||(34034675-34034743)
chr2 (150-195)||(38019382-38019427)

Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 5)
Name: chr2

Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 34029777 - 34029560
1 taaaagaccaacttggtgtttgcgggtggaactatgcttttaggtcaattcatcaacatgctaagaacaatattagatcatacactcaggctaagaaatt 100  Q
    ||||||||||||||||||| ||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
34029777 taaaagaccaacttggtgtatgcaggtggaactatgcttttaggtcacttcatcaacatgctaagaacaatattagatcatacactcaggctaagaaatt 34029678  T
101 gtcatctgcttcttctgctgctgtttccaacaaggtgaaaagaaccaaggaagaatctatgaagaaagtcatggacttgaattgttggggtcctagtact 200  Q
34029677 gtcatctgcttcttctgctgctgtttccaacaaggtgaaaagaaccaaggaagaatctatgaagaaagtcatggacttgaattgttggggtcctagtact 34029578  T
201 gcaaggttttaatattgt 218  Q
34029577 gcaaggttttaatattgt 34029560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 34031712 - 34031495
1 taaaagaccaacttggtgtttgcgggtggaactatgcttttaggtcaattcatcaacatgctaagaacaatattagatcatacactcaggctaagaaatt 100  Q
    ||||||||||||||||||| ||| ||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |||| || ||||||||    
34031712 taaaagaccaacttggtgtatgcaggtggaactatgcttttagatcacttcatcaacatgctaagaacaatattagatcatactctcaagccaagaaatt 34031613  T
101 gtcatctgcttcttctgctgctgtttccaacaaggtgaaaagaaccaaggaagaatctatgaagaaagtcatggacttgaattgttggggtcctagtact 200  Q
    ||| |||||||| |||||||||||||| || |||||||| |||| ||||||||||||||||| ||||||||| ||||||||||| |||||||||||||||    
34031612 gtcctctgcttcatctgctgctgtttcgaataaggtgaagagaagcaaggaagaatctatgaggaaagtcattgacttgaattgctggggtcctagtact 34031513  T
201 gcaaggttttaatattgt 218  Q
34031512 gcaaggttttaatattgt 34031495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 34026849 - 34026632
1 taaaagaccaacttggtgtttgcgggtggaactatgcttttaggtcaattcatcaacatgctaagaacaatattagatcatacactcaggctaagaaatt 100  Q
    ||||||||||||||||||| ||| |||||||| || ||||||| ||  ||||||| |||||||||| |||||| |||||||||||| |||| ||||||||    
34026849 taaaagaccaacttggtgtatgcaggtggaaccattcttttagatcctttcatcagcatgctaagagcaatatcagatcatacactaaggccaagaaatt 34026750  T
101 gtcatctgcttcttctgctgctgtttccaacaaggtgaaaagaaccaaggaagaatctatgaagaaagtcatggacttgaattgttggggtcctagtact 200  Q
    ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||| |||||||||||| ||||||||||||||    
34026749 gtcatctgcttcttctgctgctgtttccaacaaggtgaagagaagcaaggaagaatctatgaggaaagtcattgacttgaattgtcggggtcctagtact 34026650  T
201 gcaaggttttaatattgt 218  Q
34026649 tcaaggttttaatattgt 34026632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 125 - 193
Target Start/End: Complemental strand, 34034743 - 34034675
125 ttccaacaaggtgaaaagaaccaaggaagaatctatgaagaaagtcatggacttgaattgttggggtcc 193  Q
    ||||||||||| ||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
34034743 ttccaacaaggggaagagaaacaaggaagaatctatgaagaaagtcatggacctgaattgttggggtcc 34034675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 150 - 195
Target Start/End: Original strand, 38019382 - 38019427
150 gaagaatctatgaagaaagtcatggacttgaattgttggggtccta 195  Q
    ||||||||| ||| |||||||||| |||||| ||||||||||||||    
38019382 gaagaatctttgaggaaagtcatgtacttgagttgttggggtccta 38019427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 115694 times since January 2019
Visitors: 1394