View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_high_12 (Length: 463)

Name: NF1429_high_12
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1429_high_12
[»] chr8 (1 HSPs)
chr8 (1-449)||(44883892-44884340)
[»] chr2 (5 HSPs)
chr2 (49-393)||(8994206-8994574)
chr2 (49-309)||(9028863-9029120)
chr2 (10-91)||(9019385-9019466)
chr2 (256-393)||(9007176-9007334)
chr2 (307-393)||(9029136-9029231)

Alignment Details
Target: chr8 (Bit Score: 429; Significance: 0; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 429; E-Value: 0
Query Start/End: Original strand, 1 - 449
Target Start/End: Complemental strand, 44884340 - 44883892
1 tgagtatgatcgtttgtcttcaaacccttctccttcaccttctcgactcagattgttcctcttcttctcaaaaccagatactgctgtttccatgggaaat 100  Q
44884340 tgagtatgatcgtttgtcttcaaacccttctccttcaccttctcgactcagattgttcctcttcttctcaaaaccagatactgctgtttccatgggaaat 44884241  T
101 ggtcacttttataatcatgcgtggtttgtggaagctctcaacaactcagggattctgtctcgtgttgtttcggattctgcagctgctgttgataactgcc 200  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
44884240 ggtcacttttataatcatgcatggtttgtggaagctctcaacaactcagggattctgtctcgtgttgtttcagattctgcagctgctgttgataactgcc 44884141  T
201 tcctcaacctcgatgattatgatattaatgcttcaagtaatgacgaaaatactaataataatgttatcaaggagcatttgattgatgttgattattcagt 300  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44884140 tcctcaacctcgatgattatgatattagtgcttcaagtaatgacgaaaatactaataataatgttatcaaggagcatttgattgatgttgattattcagt 44884041  T
301 gcctgtggaggaggaggaggagaagaacatgtttaattattcaattgctaatcttcgagttcgtgttgatcatgacgatgatggtagcggggcgaagcaa 400  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
44884040 gcctgtggaggaggaggaggagaagaacatgtttaattattcaattgctaatcttcgagttcgtgttgatcatgacgatgatggtagcggggtgaagcaa 44883941  T
401 gagcagaggcttaggatggaacaacagcatgataacaactttgataatg 449  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||    
44883940 gagcagaggcttaggatggaacaacagcatgaaaacaactttgataatg 44883892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 143; Significance: 6e-75; HSPs: 5)
Name: chr2

Target: chr2; HSP #1
Raw Score: 143; E-Value: 6e-75
Query Start/End: Original strand, 49 - 393
Target Start/End: Original strand, 8994206 - 8994574
49 cagattgttcctcttcttctcaaaaccagatactgctgtttccatgggaaatggtcacttttataatcatgcgtggtttgtggaagctctcaacaactca 148  Q
    |||||||||||| |||||||||||||||||||||| |||||||||||| |||| ||||||| ||||||||| |||||||||||||||||| ||||| |||    
8994206 cagattgttcctattcttctcaaaaccagatactgatgtttccatgggtaatgatcactttgataatcatgtgtggtttgtggaagctctgaacaaatca 8994305  T
149 gggattctgtctcgtgttgtttcggattctgcagctgctgttgataactgcctcctcaacctcgatgattatgatattaatgcttcaagtaatgacgaaa 248  Q
    |||||||| |||||||||||||| | |||||| || | ||| |||||||||||||||||||| |||||||||||| ||| ||||||||  ||||| ||||    
8994306 gggattctctctcgtgttgtttctgtttctgctgcggttgtggataactgcctcctcaaccttgatgattatgatgttagtgcttcaatcaatgatgaaa 8994405  T
249 atactaataataatgttatcaaggagcatttgattgatgttgattattcagtgcctgtgga------------------ggaggaggaggagaagaacat 330  Q
    |||||||||||   ||||  ||||||||||||||||||||||| |||||||| | ||||||                  ||| ||||||||| |||||||    
8994406 atactaataat---gttaaaaaggagcatttgattgatgttgactattcagttcttgtggatgatgatgatgaggaggaggaagaggaggaggagaacat 8994502  T
331 gtttaattattcaattgctaatc---------ttcgagttcgtgttgatcatgacgatgatggtagcggggc 393  Q
    ||||||||||||| |||||||||         |||||||||||||||||||||| || ||||||||||||||    
8994503 gtttaattattcagttgctaatcttcctgaaattcgagttcgtgttgatcatgatgacgatggtagcggggc 8994574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 143; E-Value: 6e-75
Query Start/End: Original strand, 49 - 309
Target Start/End: Original strand, 9028863 - 9029120
49 cagattgttcctcttcttctcaaaaccagatactgctgtttccatgggaaatggtcacttttataatcatgcgtggtttgtggaagctctcaacaactca 148  Q
    |||||||||||| |||||||||||||||||||||| |||||||||||| |||| ||||||| ||||||||| |||||||||||||||||| ||||| |||    
9028863 cagattgttcctattcttctcaaaaccagatactgatgtttccatgggtaatgatcactttgataatcatgtgtggtttgtggaagctctgaacaaatca 9028962  T
149 gggattctgtctcgtgttgtttcggattctgcagctgctgttgataactgcctcctcaacctcgatgattatgatattaatgcttcaagtaatgacgaaa 248  Q
    |||||||| |||||||||||||| | |||||| || | ||| |||||||||||||||||||| |||||||||||| ||| ||||||||  ||||| ||||    
9028963 gggattctctctcgtgttgtttctgtttctgctgcggttgtggataactgcctcctcaaccttgatgattatgatgttagtgcttcaatcaatgatgaaa 9029062  T
249 atactaataataatgttatcaaggagcatttgattgatgttgattattcagtgcctgtgga 309  Q
    ||||   |||||||||||  ||||||||||||||||||||||| |||||||| | ||||||    
9029063 atac---taataatgttaaaaaggagcatttgattgatgttgactattcagttcttgtgga 9029120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 10 - 91
Target Start/End: Original strand, 9019385 - 9019466
10 tcgtttgtcttcaaacccttctccttcaccttctcgactcagattgttcctcttcttctcaaaaccagatactgctgtttcc 91  Q
    |||||||||||||||||| |||||||| ||||||||||||||||||||| | ||| |||||||||||||||||||| |||||    
9019385 tcgtttgtcttcaaacccgtctccttccccttctcgactcagattgttcatgttcatctcaaaaccagatactgctatttcc 9019466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 256 - 393
Target Start/End: Original strand, 9007176 - 9007334
256 taataatgttatcaaggagcatttgattgatgttgattattcagtgcctgtgga------------ggaggaggaggagaagaacatgtttaattattca 343  Q
    |||||||||||  ||||||||||||||||||||||| |||||||| | ||||||            |||||| |||||| ||||||||||||||||||||    
9007176 taataatgttaaaaaggagcatttgattgatgttgactattcagttcttgtggatgatgatgatgaggaggaagaggaggagaacatgtttaattattca 9007275  T
344 attgctaatc---------ttcgagttcgtgttgatcatgacgatgatggtagcggggc 393  Q
     |||||||||         |||||||||||||||||||||| || ||||||||||||||    
9007276 gttgctaatcttcctgaaattcgagttcgtgttgatcatgatgacgatggtagcggggc 9007334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 307 - 393
Target Start/End: Original strand, 9029136 - 9029231
307 ggaggaggaggaggagaagaacatgtttaattattcaattgctaatcttc---------gagttcgtgttgatcatgacgatgatggtagcggggc 393  Q
    |||||| ||||||||| |||||||||||||||| ||| ||||||||||||         ||||||||||||||||||| || ||||||||||||||    
9029136 ggaggaagaggaggaggagaacatgtttaattaatcagttgctaatcttcctgaaattcgagttcgtgttgatcatgatgacgatggtagcggggc 9029231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 18585 times since January 2019
Visitors: 1569