View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_high_14 (Length: 452)

Name: NF1429_high_14
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1429_high_14
[»] chr1 (9 HSPs)
chr1 (11-435)||(8787652-8788076)
chr1 (122-263)||(8787595-8787736)
chr1 (301-435)||(8782184-8782318)
chr1 (136-243)||(8781938-8782045)
chr1 (295-364)||(8782055-8782124)
chr1 (273-435)||(8776166-8776328)
chr1 (11-75)||(8781981-8782045)
chr1 (199-247)||(8782124-8782172)
chr1 (32-76)||(8782125-8782169)

Alignment Details
Target: chr1 (Bit Score: 376; Significance: 0; HSPs: 9)
Name: chr1

Target: chr1; HSP #1
Raw Score: 376; E-Value: 0
Query Start/End: Original strand, 11 - 435
Target Start/End: Original strand, 8787652 - 8788076
11 cacagattggtcaacctgggcagtgagtcactaggacaaaattcaagtgataagcaaaattcactattttctgatcccgcatttgaaaaaagcaatgaac 110  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8787652 cacatattggtcaacctgggcagtgagtcactaggacaaaattcaagtgataagcaaaattcactattttctgatcccgcatttgaaaaaagcaatgaac 8787751  T
111 tattccttgatcctacatatgatcctcctggttatattagcgatgatgttggtgtagatgaaggtgatcacagatcggtcaatctgggtagtgagtcgct 210  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
8787752 tattccttgatcctacatatgatcctcctggttatattagtgatgatgttggtgtagatgaaggtgatcacagattggtcaatctgggtagtgagtcgct 8787851  T
211 aggacaaagttcacgttttaagcaaaattcactagtttctgatccggcatttgnnnnnnntaatgaactaatccttaattctgcgacgagtgttgatggt 310  Q
    |||||||| |||| |||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||| ||||||||||    
8787852 aggacaaatttcatgttttaagcaaaattcactagtttctgatccggcatttgaaaaaaataatgaactaatccttaattctgcgacgattgttgatggt 8787951  T
311 gataaggagtatatgagttgtaagaataccacaaacacacccacggtggaggatgggggtaattgctccgatccagatgttactattttggaaccttatg 410  Q
8787952 gataaggagtatatgagttgtaagaataccacaaacacacccacggtggaggatgggggtaattgctccgatccagatgttactattttggaaccttatc 8788051  T
411 aagtttgtgaagatacccctttcgt 435  Q
8788052 aagtttgtgaagatacccctttcgt 8788076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 122 - 263
Target Start/End: Original strand, 8787595 - 8787736
122 cctacatatgatcctcctggttatattagcgatgatgttggtgtagatgaaggtgatcacagatcggtcaatctgggtagtgagtcgctaggacaaagtt 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || |||||| ||||| |||||||| |||||||||| ||    
8787595 cctacatatgatcctcctggttatattagcgatgatgttggtgtagatgaagatgatcacatattggtcaacctgggcagtgagtcactaggacaaaatt 8787694  T
222 cacgttttaagcaaaattcactagtttctgatccggcatttg 263  Q
    || ||  |||||||||||||||| |||||||||| |||||||    
8787695 caagtgataagcaaaattcactattttctgatcccgcatttg 8787736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 301 - 435
Target Start/End: Original strand, 8782184 - 8782318
301 tgttgatggtgataaggagtatatgagttgtaagaataccacaaacacacccacggtggaggatgggggtaattgctccgatccagatgttactattttg 400  Q
    |||||| ||||||||||||||||||  | |||||| ||||||||||||| ||| ||||||||||||||||| |  ||||||||||||||| |||||||||    
8782184 tgttgacggtgataaggagtatatgcatggtaagagtaccacaaacacatccaaggtggaggatgggggtattccctccgatccagatgtaactattttg 8782283  T
401 gaaccttatgaagtttgtgaagatacccctttcgt 435  Q
     || |||||  | ||||||||| || |||||||||    
8782284 aaatcttatccaatttgtgaagctaaccctttcgt 8782318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 136 - 243
Target Start/End: Original strand, 8781938 - 8782045
136 tcctggttatattagcgatgatgttggtgtagatgaaggtgatcacagatcggtcaatctgggtagtgagtcgctaggacaaagttcacgttttaagcaa 235  Q
    ||||||| |||| |||||||||||||||||| |||||| ||||||||||| ||| ||||| ||||||||||| |||||| |||||||| || |||||| |    
8781938 tcctggtcatatcagcgatgatgttggtgtaaatgaagatgatcacagattggttaatctaggtagtgagtcactaggaaaaagttcaagtgttaagcga 8782037  T
236 aattcact 243  Q
8782038 aattcact 8782045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 364
Target Start/End: Original strand, 8782055 - 8782124
295 gacgagtgttgatggtgataaggagtatatgagttgtaagaataccacaaacacacccacggtggaggat 364  Q
    ||||| ||||||||||||||||||||||||  || |||||||||||| ||||||| ||| ||||||||||    
8782055 gacgattgttgatggtgataaggagtatatccgtggtaagaataccaaaaacacatccaaggtggaggat 8782124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 273 - 435
Target Start/End: Original strand, 8776166 - 8776328
273 atgaactaatccttaattctgcgacgagtgttgatggtgataaggagtatatgagttgtaagaataccacaaacacacccacggtggaggatgggggtaa 372  Q
    |||||| | |||||||||||| ||||| ||||||||  |||||||||||| |  ||   ||||||||||| |||||| |||  |||||||||| |  |||    
8776166 atgaacaattccttaattctgtgacgattgttgatgacgataaggagtattttcgtgacaagaataccaccaacacatccaatgtggaggatgagaataa 8776265  T
373 ttgctccgatccagatgttactattttggaaccttatgaagtttgtgaagatacccctttcgt 435  Q
    || ||| ||| ||||| | | |||||||||  |||||  | |||||||| | |||||||||||    
8776266 ttcctctgattcagatctgattattttggattcttatccaatttgtgaaaacacccctttcgt 8776328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 11 - 75
Target Start/End: Original strand, 8781981 - 8782045
11 cacagattggtcaacctgggcagtgagtcactaggacaaaattcaagtgataagcaaaattcact 75  Q
    ||||||||||| || || || ||||||||||||||| ||| |||||||| ||||| |||||||||    
8781981 cacagattggttaatctaggtagtgagtcactaggaaaaagttcaagtgttaagcgaaattcact 8782045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 199 - 247
Target Start/End: Original strand, 8782124 - 8782172
199 tagtgagtcgctaggacaaagttcacgttttaagcaaaattcactagtt 247  Q
    ||||||||| ||||||||||||||| || |||||| |||||||||||||    
8782124 tagtgagtcactaggacaaagttcaagtgttaagcgaaattcactagtt 8782172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 32 - 76
Target Start/End: Original strand, 8782125 - 8782169
32 agtgagtcactaggacaaaattcaagtgataagcaaaattcacta 76  Q
    ||||||||||||||||||| |||||||| ||||| ||||||||||    
8782125 agtgagtcactaggacaaagttcaagtgttaagcgaaattcacta 8782169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 18023 times since January 2019
Visitors: 1567