View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_high_18 (Length: 404)

Name: NF1429_high_18
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1429_high_18
[»] chr8 (1 HSPs)
chr8 (1-387)||(44883954-44884340)
[»] chr2 (6 HSPs)
chr2 (49-309)||(8994206-8994463)
chr2 (49-309)||(9028863-9029120)
chr2 (10-91)||(9019385-9019466)
chr2 (256-356)||(9007176-9007288)
chr2 (307-356)||(8994479-8994528)
chr2 (307-356)||(9029136-9029185)

Alignment Details
Target: chr8 (Bit Score: 375; Significance: 0; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 375; E-Value: 0
Query Start/End: Original strand, 1 - 387
Target Start/End: Complemental strand, 44884340 - 44883954
1 tgagtatgatcgtttgtcttcaaacccttctccttcaccttctcgactcagattgttcctcttcttctcaaaaccagatactgctgtttccatgggaaat 100  Q
44884340 tgagtatgatcgtttgtcttcaaacccttctccttcaccttctcgactcagattgttcctcttcttctcaaaaccagatactgctgtttccatgggaaat 44884241  T
101 ggtcacttttataatcatgcgtggtttgtggaagctctcaacaactcagggattctgtctcgtgttgtttcggattctgcagctgctgttgataactgcc 200  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
44884240 ggtcacttttataatcatgcatggtttgtggaagctctcaacaactcagggattctgtctcgtgttgtttcagattctgcagctgctgttgataactgcc 44884141  T
201 tcctcaacctcgatgattatgatattaatgcttcaagtaatgacgaaaatactaataataatgttatcaaggagcatttgattgatgttgattattcagt 300  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44884140 tcctcaacctcgatgattatgatattagtgcttcaagtaatgacgaaaatactaataataatgttatcaaggagcatttgattgatgttgattattcagt 44884041  T
301 gcctgtggaggaggaggaggagaagaacatgtttaattattcaattgctaatcttcgagttcgtgttgatcatgacgatgatggtag 387  Q
44884040 gcctgtggaggaggaggaggagaagaacatgtttaattattcaattgctaatcttcgagttcgtgttgatcatgacgatgatggtag 44883954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 143; Significance: 5e-75; HSPs: 6)
Name: chr2

Target: chr2; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 49 - 309
Target Start/End: Original strand, 8994206 - 8994463
49 cagattgttcctcttcttctcaaaaccagatactgctgtttccatgggaaatggtcacttttataatcatgcgtggtttgtggaagctctcaacaactca 148  Q
    |||||||||||| |||||||||||||||||||||| |||||||||||| |||| ||||||| ||||||||| |||||||||||||||||| ||||| |||    
8994206 cagattgttcctattcttctcaaaaccagatactgatgtttccatgggtaatgatcactttgataatcatgtgtggtttgtggaagctctgaacaaatca 8994305  T
149 gggattctgtctcgtgttgtttcggattctgcagctgctgttgataactgcctcctcaacctcgatgattatgatattaatgcttcaagtaatgacgaaa 248  Q
    |||||||| |||||||||||||| | |||||| || | ||| |||||||||||||||||||| |||||||||||| ||| ||||||||  ||||| ||||    
8994306 gggattctctctcgtgttgtttctgtttctgctgcggttgtggataactgcctcctcaaccttgatgattatgatgttagtgcttcaatcaatgatgaaa 8994405  T
249 atactaataataatgttatcaaggagcatttgattgatgttgattattcagtgcctgtgga 309  Q
    ||||   |||||||||||  ||||||||||||||||||||||| |||||||| | ||||||    
8994406 atac---taataatgttaaaaaggagcatttgattgatgttgactattcagttcttgtgga 8994463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 49 - 309
Target Start/End: Original strand, 9028863 - 9029120
49 cagattgttcctcttcttctcaaaaccagatactgctgtttccatgggaaatggtcacttttataatcatgcgtggtttgtggaagctctcaacaactca 148  Q
    |||||||||||| |||||||||||||||||||||| |||||||||||| |||| ||||||| ||||||||| |||||||||||||||||| ||||| |||    
9028863 cagattgttcctattcttctcaaaaccagatactgatgtttccatgggtaatgatcactttgataatcatgtgtggtttgtggaagctctgaacaaatca 9028962  T
149 gggattctgtctcgtgttgtttcggattctgcagctgctgttgataactgcctcctcaacctcgatgattatgatattaatgcttcaagtaatgacgaaa 248  Q
    |||||||| |||||||||||||| | |||||| || | ||| |||||||||||||||||||| |||||||||||| ||| ||||||||  ||||| ||||    
9028963 gggattctctctcgtgttgtttctgtttctgctgcggttgtggataactgcctcctcaaccttgatgattatgatgttagtgcttcaatcaatgatgaaa 9029062  T
249 atactaataataatgttatcaaggagcatttgattgatgttgattattcagtgcctgtgga 309  Q
    ||||   |||||||||||  ||||||||||||||||||||||| |||||||| | ||||||    
9029063 atac---taataatgttaaaaaggagcatttgattgatgttgactattcagttcttgtgga 9029120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 10 - 91
Target Start/End: Original strand, 9019385 - 9019466
10 tcgtttgtcttcaaacccttctccttcaccttctcgactcagattgttcctcttcttctcaaaaccagatactgctgtttcc 91  Q
    |||||||||||||||||| |||||||| ||||||||||||||||||||| | ||| |||||||||||||||||||| |||||    
9019385 tcgtttgtcttcaaacccgtctccttccccttctcgactcagattgttcatgttcatctcaaaaccagatactgctatttcc 9019466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 256 - 356
Target Start/End: Original strand, 9007176 - 9007288
256 taataatgttatcaaggagcatttgattgatgttgattattcagtgcctgtgga------------ggaggaggaggagaagaacatgtttaattattca 343  Q
    |||||||||||  ||||||||||||||||||||||| |||||||| | ||||||            |||||| |||||| ||||||||||||||||||||    
9007176 taataatgttaaaaaggagcatttgattgatgttgactattcagttcttgtggatgatgatgatgaggaggaagaggaggagaacatgtttaattattca 9007275  T
344 attgctaatcttc 356  Q
9007276 gttgctaatcttc 9007288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 307 - 356
Target Start/End: Original strand, 8994479 - 8994528
307 ggaggaggaggaggagaagaacatgtttaattattcaattgctaatcttc 356  Q
    |||||| ||||||||| |||||||||||||||||||| ||||||||||||    
8994479 ggaggaagaggaggaggagaacatgtttaattattcagttgctaatcttc 8994528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 307 - 356
Target Start/End: Original strand, 9029136 - 9029185
307 ggaggaggaggaggagaagaacatgtttaattattcaattgctaatcttc 356  Q
    |||||| ||||||||| |||||||||||||||| ||| ||||||||||||    
9029136 ggaggaagaggaggaggagaacatgtttaattaatcagttgctaatcttc 9029185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 17970 times since January 2019
Visitors: 1567