View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_high_19 (Length: 402)

Name: NF1429_high_19
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1429_high_19
[»] chr1 (5 HSPs)
chr1 (1-394)||(11025789-11026182)
chr1 (3-387)||(11040494-11040878)
chr1 (1-394)||(10930129-10930522)
chr1 (1-394)||(10992333-10992726)
chr1 (19-64)||(10991327-10991372)

Alignment Details
Target: chr1 (Bit Score: 390; Significance: 0; HSPs: 5)
Name: chr1

Target: chr1; HSP #1
Raw Score: 390; E-Value: 0
Query Start/End: Original strand, 1 - 394
Target Start/End: Original strand, 11025789 - 11026182
1 catttttcttaagttagctttcataaatgcaggatcaattttaggatcattgttttttatcttgttgattggtggaatctaccatatttatgactcttgc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
11025789 catttttcttaagttagctttcataaatgcaggatcaattttaggatcattgttttttatcttgttgattggtggaatctaccatatttatgactcttac 11025888  T
101 atactaaagaaagaaaaacaagcaattgtagaaaagtttttagaagactatagagttcttaagcccaccagatactcttatgtagaaatcaagagaatca 200  Q
11025889 atactaaagaaagaaaaacaagcaattgtagaaaagtttttagaagactatagagttcttaagcccaccagatactcttatgtagaaatcaagagaatca 11025988  T
201 caaataatttcggggatatgttaggacaaggagcctatggaactgtttataaaggaagcatttcaaaagaatttagtgttgctgtgaagatactaaatgt 300  Q
11025989 caaataatttcggggatatgttaggacaaggagcctatggaactgtttataaaggaagcatttcaaaagaatttagtgttgctgtgaagatactaaatgt 11026088  T
301 ttctcagggaaatggccaagacttcctaaatgaagttggtacaatgagtagaatccaccatgttaatattgtccgattggtcggtttctgtgct 394  Q
11026089 ttctcagggaaatggccaagacttcctaaatgaagttggtacaatgagtagaatccaccatgttaatattgtccgattggtcggtttctgtgct 11026182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 3 - 387
Target Start/End: Original strand, 11040494 - 11040878
3 tttttcttaagttagctttcataaatgcaggatcaattttaggatcattgttttttatcttgttgattggtggaatctaccatatttatgactcttgcat 102  Q
    |||||||||| ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| ||| ||||||||||||||||| |||    
11040494 tttttcttaaattagctttcataaatgcaggatcaattttaggatcgttgtttttcatcttgttgattggtggagtcttccatatttatgactcttacat 11040593  T
103 actaaagaaagaaaaacaagcaattgtagaaaagtttttagaagactatagagttcttaagcccaccagatactcttatgtagaaatcaagagaatcaca 202  Q
    ||||| ||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||||||||||||    
11040594 actaaggaaagaaaaacaagcaattatagaaaagtttttagaagactatagagctcttaagccaaccagatactcttatgtagaaattaagagaatcaca 11040693  T
203 aataatttcggggatatgttaggacaaggagcctatggaactgtttataaaggaagcatttcaaaagaatttagtgttgctgtgaagatactaaatgttt 302  Q
11040694 aataatttcggggatatgttaggacaaggagcctatggaactgtttataaaggaagcatttcaaaagaatttagtgttgctgtgaagatactaaatgttt 11040793  T
303 ctcagggaaatggccaagacttcctaaatgaagttggtacaatgagtagaatccaccatgttaatattgtccgattggtcggttt 387  Q
    |||||||||||||||||||||||||||||||||| ||||||||| ||||||| ||||||||||||||||| || ||| |||||||    
11040794 ctcagggaaatggccaagacttcctaaatgaagtgggtacaatgggtagaatacaccatgttaatattgttcgtttgatcggttt 11040878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 394
Target Start/End: Original strand, 10930129 - 10930522
1 catttttcttaagttagctttcataaatgcaggatcaattttaggatcattgttttttatcttgttgattggtggaatctaccatatttatgactcttgc 100  Q
    |||||||||||| |||  ||||||||||||||||||||||||||| || || |||||| ||||||||| ||||| ||||||||||||||||||||||| |    
10930129 catttttcttaaattaattttcataaatgcaggatcaattttaggttcgttattttttgtcttgttgactggtgcaatctaccatatttatgactcttac 10930228  T
101 atactaaagaaagaaaaacaagcaattgtagaaaagtttttagaagactatagagttcttaagcccaccagatactcttatgtagaaatcaagagaatca 200  Q
    |||| |||||||||||||||||| ||| ||||||||||||||||||| ||||||| |||||||||||| |||||||| |||| |||||| || |||||||    
10930229 atacaaaagaaagaaaaacaagccattatagaaaagtttttagaagattatagagctcttaagcccacaagatactcatatgaagaaattaaaagaatca 10930328  T
201 caaataatttcggggatatgttaggacaaggagcctatggaactgtttataaaggaagcatttcaaaagaatttagtgttgctgtgaagatactaaatgt 300  Q
    |||||||||| || || | |||||||||||| |||||||||||||| |||| ||||||||||||||||||| | | ||||||||||||||||||||||||    
10930329 caaataattttggcgacaagttaggacaaggtgcctatggaactgtatatagaggaagcatttcaaaagaaatcattgttgctgtgaagatactaaatgt 10930428  T
301 ttctcagggaaatggccaagacttcctaaatgaagttggtacaatgagtagaatccaccatgttaatattgtccgattggtcggtttctgtgct 394  Q
    ||| || ||||| || ||||| ||||| |||||||||||||||||| |||||||||| ||||||||||||||  ||||||||||||||||||||    
10930429 ttcacaaggaaacgggcaagatttcctcaatgaagttggtacaatgggtagaatccatcatgttaatattgttagattggtcggtttctgtgct 10930522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 394
Target Start/End: Original strand, 10992333 - 10992726
1 catttttcttaagttagctttcataaatgcaggatcaattttaggatcattgttttttatcttgttgattggtggaatctaccatatttatgactcttgc 100  Q
    |||||||||||| |||| |||||||||| ||||||||||| |||||||  |||||||| ||||||| |  |||| | |||||||  |||||||||||| |    
10992333 catttttcttaaattagttttcataaatccaggatcaattctaggatcgctgttttttgtcttgttaaccggtgcagtctaccacgtttatgactcttac 10992432  T
101 atactaaagaaagaaaaacaagcaattgtagaaaagtttttagaagactatagagttcttaagcccaccagatactcttatgtagaaatcaagagaatca 200  Q
    ||||| || |||| ||||||||||||| ||||||||||||||||||| ||||||| |||||| ||||| |||||||||||||||||||| ||||||||||    
10992433 atactgaacaaagcaaaacaagcaattatagaaaagtttttagaagattatagagctcttaaacccacgagatactcttatgtagaaattaagagaatca 10992532  T
201 caaataatttcggggatatgttaggacaaggagcctatggaactgtttataaaggaagcatttcaaaagaatttagtgttgctgtgaagatactaaatgt 300  Q
    ||||||| ||  | || | |||||||||||| |||||||||||||| |||| ||||||||||||||||||| | | |||||||||||||||||||||| |    
10992533 caaataactttagtgacaagttaggacaaggtgcctatggaactgtatatagaggaagcatttcaaaagaaatcattgttgctgtgaagatactaaattt 10992632  T
301 ttctcagggaaatggccaagacttcctaaatgaagttggtacaatgagtagaatccaccatgttaatattgtccgattggtcggtttctgtgct 394  Q
    |||||| ||||| || ||||| ||||| |||||||||||||||||  |||||| ||| ||||||||||||||  ||||||||||||||||||||    
10992633 ttctcaaggaaacgggcaagatttcctcaatgaagttggtacaattggtagaacccatcatgttaatattgttagattggtcggtttctgtgct 10992726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 64
Target Start/End: Original strand, 10991327 - 10991372
19 tttcataaatgcaggatcaattttaggatcattgttttttatcttg 64  Q
    ||||||||||||||| ||||||||||||||| ||||||||||||||    
10991327 tttcataaatgcagggtcaattttaggatcaatgttttttatcttg 10991372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 14390 times since January 2019
Visitors: 566