View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_high_22 (Length: 376)

Name: NF1429_high_22
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1429_high_22
[»] chr4 (1 HSPs)
chr4 (14-362)||(15026230-15026578)
[»] chr1 (1 HSPs)
chr1 (83-362)||(21365698-21365977)
[»] chr3 (1 HSPs)
chr3 (139-362)||(26695899-26696122)

Alignment Details
Target: chr4 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 14 - 362
Target Start/End: Original strand, 15026230 - 15026578
14 atatgtaaatgtactaaatcttgaaataataataatgtttgtgtgtatatattctgattaaataactaaaatgcaggcacaatacttgaaaaacgatcca 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
15026230 atatgtaaatgtactaaatcttgaaataataataatgtttgtgtgtatatattctgattaaataactaaaatgtaggcacaatacttgaaaaacgatcca 15026329  T
114 gattacatgagctgcaaaaagaaagaatgcaagaaagaacagaatgggaaatgcagtgtgacaacttgtagtggttcaataaagtttcatgttatcaaca 213  Q
15026330 gattacatgagctgcaaaaagaaagaatgcaagaaagaacagaatgggaaatgcagtgtgacaacttgtagtggttcaataaagtttcatgttatcaaca 15026429  T
214 ttagaagtgatatagagtttgtgttcttcactggtggctttctcaccccctgccttgttggaagatccactcctttgagttttgctaatcctaagaagcc 313  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| ||||| |||||||||||||||||||||||||||||||||||    
15026430 ttagaagtgatatagaatttgtgttcttcactggtggctttctcaccccgtgccttgtcggaaggtccactcctttgagttttgctaatcctaagaagcc 15026529  T
314 actttatggacatatctcaagtatagattcaactgcaacatcggtaagt 362  Q
15026530 actttatggacatatctcaagtatagattcaactgcaacatcggtaagt 15026578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 83 - 362
Target Start/End: Original strand, 21365698 - 21365977
83 aatgcaggcacaatacttgaaaaacgatccagattacatgagctgcaaaaagaaagaatgcaagaaagaacagaatgggaaatgcagtgtgacaacttgt 182  Q
    |||| ||||||| |||||||||||||||||||||||| | || |||||||||||||||||||||||||| |  ||||| ||||||| ||||||||||||     
21365698 aatgtaggcacagtacttgaaaaacgatccagattacctaagttgcaaaaagaaagaatgcaagaaagagcttaatggaaaatgcattgtgacaacttgc 21365797  T
183 agtggttcaataaagtttcatgttatcaacattagaagtgatatagagtttgtgttcttcactggtggctttctcaccccctgccttgttggaagatcca 282  Q
    |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |||||||||||||||||||| |||||| ||||||| ||||    
21365798 agtggttcaataaagtttcatgttatcaacataagaagtgacatagagtttgtgttctttactggtggctttctcaccccttgccttattggaaggtcca 21365897  T
283 ctcctttgagttttgctaatcctaagaagccactttatggacatatctcaagtatagattcaactgcaacatcggtaagt 362  Q
    |||||||| |||||||||||||||| |||||||||||||||||| ||||||| |||||||||||||| ||||| ||||||    
21365898 ctcctttgggttttgctaatcctaacaagccactttatggacatctctcaagcatagattcaactgctacatcagtaagt 21365977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 140; Significance: 3e-73; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 139 - 362
Target Start/End: Original strand, 26695899 - 26696122
139 aatgcaagaaagaacagaatgggaaatgcagtgtgacaacttgtagtggttcaataaagtttcatgttatcaacattagaagtgatatagagtttgtgtt 238  Q
    ||||||||||||| |  ||||||||||||| ||||||||||||||||||||||||||||||||||||||  ||||| |||||||| ||||| ||||||||    
26695899 aatgcaagaaagagcttaatgggaaatgcattgtgacaacttgtagtggttcaataaagtttcatgttacaaacataagaagtgacatagaatttgtgtt 26695998  T
239 cttcactggtggctttctcaccccctgccttgttggaagatccactcctttgagttttgctaatcctaagaagccactttatggacatatctcaagtata 338  Q
    ||| |||||||| ||||||| |||||||||| ||||||| |||||||||||| | ||| |||||||||| |||||||||||||||||| ||||||| |||    
26695999 ctttactggtgggtttctcagcccctgcctttttggaaggtccactcctttgggattttctaatcctaacaagccactttatggacatctctcaagcata 26696098  T
339 gattcaactgcaacatcggtaagt 362  Q
    ||||||||||||||||| ||||||    
26696099 gattcaactgcaacatcagtaagt 26696122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 116132 times since January 2019
Visitors: 1395