View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_high_31 (Length: 314)

Name: NF1429_high_31
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1429_high_31
[»] chr3 (1 HSPs)
chr3 (1-300)||(34685348-34685657)

Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 300
Target Start/End: Complemental strand, 34685657 - 34685348
1 ctgctggtaataatatagttgtgtgtgtgttgagaagtgaacggctgcaacacaattttggtcat--------agatgtataagatgtatggaatcacat 92  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||        |||||||||||||||||||||||||||    
34685657 ctgctggtaataatatagttgtgtgtgtgttgagaagtgaacggttgcaacacaattttggtcattcatgtgtagatgtataagatgtatggaatcacat 34685558  T
93 tttagaattcaaattattgctgaattttagttaaatttgaattgattgagagtgtcccaatttaaatatgaccggaaccatcataagttgaataagttta 192  Q
     ||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34685557 gttagaattcaagttattgctgaattttagttaaagttgaattgattgagagtgtcccaatttaaatatgaccggaaccatcataagttgaataagttta 34685458  T
193 gttgaactatggcaactccattggggaatagtggactgaaataaatgaataaaaaacatgagtannnnnnnncct--aagagaaaaatatgagtataatt 290  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         ||   ||||||||||||||||||||||    
34685457 gttgaactatggcaactccattggggaatagtggactgaaataaatgaataaaaaacatgagtatttttttttctgagagagaaaaatatgagtataatt 34685358  T
291 aaagaggagt 300  Q
34685357 aaagaggagt 34685348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 125126 times since January 2019
Visitors: 1453