View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_high_34 (Length: 284)

Name: NF1429_high_34
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1429_high_34
NF1429_high_34
[»] chr1 (7 HSPs)
chr1 (11-267)||(8787820-8788076)
chr1 (133-267)||(8782184-8782318)
chr1 (127-196)||(8782055-8782124)
chr1 (19-95)||(8787660-8787736)
chr1 (105-267)||(8776166-8776328)
chr1 (11-75)||(8781981-8782045)
chr1 (31-79)||(8782124-8782172)


Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-118; HSPs: 7)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 11 - 267
Target Start/End: Original strand, 8787820 - 8788076
Alignment:
11 cacagatcggtcaatctgggtagtgagtcgctaggacaaagttcacgttttaagcaaaattcactagtttctgatccggcatttgnnnnnnntaatgaac 110  Q
    ||||||| |||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||       ||||||||    
8787820 cacagattggtcaatctgggtagtgagtcgctaggacaaatttcatgttttaagcaaaattcactagtttctgatccggcatttgaaaaaaataatgaac 8787919  T
111 taatccttaattctgcgacgagtgttgatggtgataaggagtatatgagttgtaagaataccacaaacacacccacggtggaggatgggggtaattgctc 210  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8787920 taatccttaattctgcgacgattgttgatggtgataaggagtatatgagttgtaagaataccacaaacacacccacggtggaggatgggggtaattgctc 8788019  T
211 cgatccagatgttactattttggaaccttatgaagtttgtgaagatacccctttcgt 267  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
8788020 cgatccagatgttactattttggaaccttatcaagtttgtgaagatacccctttcgt 8788076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 133 - 267
Target Start/End: Original strand, 8782184 - 8782318
Alignment:
133 tgttgatggtgataaggagtatatgagttgtaagaataccacaaacacacccacggtggaggatgggggtaattgctccgatccagatgttactattttg 232  Q
    |||||| ||||||||||||||||||  | |||||| ||||||||||||| ||| ||||||||||||||||| |  ||||||||||||||| |||||||||    
8782184 tgttgacggtgataaggagtatatgcatggtaagagtaccacaaacacatccaaggtggaggatgggggtattccctccgatccagatgtaactattttg 8782283  T
233 gaaccttatgaagtttgtgaagatacccctttcgt 267  Q
     || |||||  | ||||||||| || |||||||||    
8782284 aaatcttatccaatttgtgaagctaaccctttcgt 8782318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 127 - 196
Target Start/End: Original strand, 8782055 - 8782124
Alignment:
127 gacgagtgttgatggtgataaggagtatatgagttgtaagaataccacaaacacacccacggtggaggat 196  Q
    ||||| ||||||||||||||||||||||||  || |||||||||||| ||||||| ||| ||||||||||    
8782055 gacgattgttgatggtgataaggagtatatccgtggtaagaataccaaaaacacatccaaggtggaggat 8782124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 19 - 95
Target Start/End: Original strand, 8787660 - 8787736
Alignment:
19 ggtcaatctgggtagtgagtcgctaggacaaagttcacgttttaagcaaaattcactagtttctgatccggcatttg 95  Q
    |||||| ||||| |||||||| |||||||||| |||| ||  |||||||||||||||| |||||||||| |||||||    
8787660 ggtcaacctgggcagtgagtcactaggacaaaattcaagtgataagcaaaattcactattttctgatcccgcatttg 8787736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 105 - 267
Target Start/End: Original strand, 8776166 - 8776328
Alignment:
105 atgaactaatccttaattctgcgacgagtgttgatggtgataaggagtatatgagttgtaagaataccacaaacacacccacggtggaggatgggggtaa 204  Q
    |||||| | |||||||||||| ||||| ||||||||  |||||||||||| |  ||   ||||||||||| |||||| |||  |||||||||| |  |||    
8776166 atgaacaattccttaattctgtgacgattgttgatgacgataaggagtattttcgtgacaagaataccaccaacacatccaatgtggaggatgagaataa 8776265  T
205 ttgctccgatccagatgttactattttggaaccttatgaagtttgtgaagatacccctttcgt 267  Q
    || ||| ||| ||||| | | |||||||||  |||||  | |||||||| | |||||||||||    
8776266 ttcctctgattcagatctgattattttggattcttatccaatttgtgaaaacacccctttcgt 8776328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 11 - 75
Target Start/End: Original strand, 8781981 - 8782045
Alignment:
11 cacagatcggtcaatctgggtagtgagtcgctaggacaaagttcacgttttaagcaaaattcact 75  Q
    ||||||| ||| ||||| ||||||||||| |||||| |||||||| || |||||| |||||||||    
8781981 cacagattggttaatctaggtagtgagtcactaggaaaaagttcaagtgttaagcgaaattcact 8782045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 31 - 79
Target Start/End: Original strand, 8782124 - 8782172
Alignment:
31 tagtgagtcgctaggacaaagttcacgttttaagcaaaattcactagtt 79  Q
    ||||||||| ||||||||||||||| || |||||| |||||||||||||    
8782124 tagtgagtcactaggacaaagttcaagtgttaagcgaaattcactagtt 8782172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175638 times since January 2019
Visitors: 2679