View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_high_41 (Length: 256)

Name: NF1429_high_41
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1429_high_41
[»] chr7 (2 HSPs)
chr7 (1-256)||(4814721-4814976)
chr7 (1-256)||(4782290-4782545)
[»] chr1 (3 HSPs)
chr1 (57-152)||(36132446-36132544)
chr1 (103-155)||(18786921-18786973)
chr1 (57-158)||(17427621-17427724)
[»] chr5 (1 HSPs)
chr5 (71-158)||(21321923-21322012)
[»] chr2 (2 HSPs)
chr2 (102-158)||(31122676-31122733)
chr2 (101-157)||(15676553-15676609)

Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr7

Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 4814976 - 4814721
1 ttgtttttaggggatttgatcccttggatgcttggtgagctgaagtctataggtaattgaatttagtttttgtggtcattcaggaggaagtgtgggttac 100  Q
    |||||||||||||||||||||||||||||| |  |  |  ||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||    
4814976 ttgtttttaggggatttgatcccttggatgatcaggtaattgaagtcgataggtaattgaatttagtttctgtggtcattcaggaggaagtgtgggttac 4814877  T
101 gctttgattcaggtgttaactttgattttggtggttaattttcttattggtgttggtgatagtacttggttcggtagtgttcgtattagtgcttttgtgg 200  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |    
4814876 gctttgattcaggtgttaactttggttttggtggttaattttcttattggtgttggtgatagtacttggttgggtagtgttcgtatcagtgcttttgtag 4814777  T
201 gtttttcttttaggtgttccattatatacgacacctttgctttgtaatttttgtat 256  Q
    |||| ||||||||||||||||||||||||||||||||||||||||| |||||||||    
4814776 gtttctcttttaggtgttccattatatacgacacctttgctttgtagtttttgtat 4814721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 4782545 - 4782290
1 ttgtttttaggggatttgatcccttggatgcttggtgagctgaagtctataggtaattgaatttagtttttgtggtcattcaggaggaagtgtgggttac 100  Q
    |||||||||||||||||||||||||||||| |  |  |  ||||||| ||||| ||||||||||||||| ||||||||||||||||||||||||||||||    
4782545 ttgtttttaggggatttgatcccttggatgatcaggtaattgaagtcgataggaaattgaatttagtttctgtggtcattcaggaggaagtgtgggttac 4782446  T
101 gctttgattcaggtgttaactttgattttggtggttaattttcttattggtgttggtgatagtacttggttcggtagtgttcgtattagtgcttttgtgg 200  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |    
4782445 gctttgattcaggtgttaactttggttttggtggttaattttcttattggtgttggtgatagtacttggttaggtagtgttcgtataagtgcttttgtag 4782346  T
201 gtttttcttttaggtgttccattatatacgacacctttgctttgtaatttttgtat 256  Q
    |||| ||||||||||||||||||||||||||||||||||||||||| |||||||||    
4782345 gtttctcttttaggtgttccattatatacgacacctttgctttgtagtttttgtat 4782290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr1

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 57 - 152
Target Start/End: Complemental strand, 36132544 - 36132446
57 ttgaatttagtttttgtggtcattcaggaggaagtgt--gggttacg-ctttgattcaggtgttaactttgattttggtggttaattttcttattggtg 152  Q
    |||| ||| ||||||||||||||||| ||||||||||  |||||||| |||||||| | |||||  |||||||||||||  ||  ||||||||||||||    
36132544 ttgatttttgtttttgtggtcattcatgaggaagtgttggggttacgtctttgatttaagtgttggctttgattttggtaatttgttttcttattggtg 36132446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 103 - 155
Target Start/End: Complemental strand, 18786973 - 18786921
103 tttgattcaggtgttaactttgattttggtggttaattttcttattggtgttg 155  Q
    ||||||| ||||||| |||||||||| |||||||| |||| ||||||||||||    
18786973 tttgatttaggtgttgactttgatttcggtggttattttttttattggtgttg 18786921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 57 - 158
Target Start/End: Complemental strand, 17427724 - 17427621
57 ttgaatttagtttttgtggtcattcaggaggaagtgtgggttac-gctttgattcaggtgttaactttgatttt-ggtggttaattttcttattggtgtt 154  Q
    |||||||| |||| ||| |||||||  ||||||||||||| |   | ||||| | | ||||| ||||||||||| |||||||| ||||||||||||||||    
17427724 ttgaattttgtttatgttgtcattcgcgaggaagtgtggggtcttgatttgacttaagtgttgactttgatttttggtggttatttttcttattggtgtt 17427625  T
155 ggtg 158  Q
17427624 ggtg 17427621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 158
Target Start/End: Complemental strand, 21322012 - 21321923
71 tgtggtcattcaggaggaagtgtgggttacg--ctttgattcaggtgttaactttgattttggtggttaattttcttattggtgttggtg 158  Q
    |||||||||||| |||||||||||||  |    |||||||| |  ||||||||||| ||||||| || | ||||||||||||||||||||    
21322012 tgtggtcattcatgaggaagtgtgggcgattgactttgatttaaatgttaactttggttttggtagtcagttttcttattggtgttggtg 21321923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 2)
Name: chr2

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 102 - 158
Target Start/End: Complemental strand, 31122733 - 31122676
102 ctttgattcaggtgttaactttgattttggtggttaatttt-cttattggtgttggtg 158  Q
    |||||||| ||||||| |||||| |||| ||||||| |||| ||||||||||||||||    
31122733 ctttgatttaggtgttgactttggttttagtggttagttttacttattggtgttggtg 31122676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 101 - 157
Target Start/End: Complemental strand, 15676609 - 15676553
101 gctttgattcaggtgttaactttgattttggtggttaattttcttattggtgttggt 157  Q
    |||||| || ||||||| |||||| ||||| ||||||  ||||||||||||||||||    
15676609 gctttggtttaggtgttgactttggttttgctggttagatttcttattggtgttggt 15676553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 175800 times since January 2019
Visitors: 2679