View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_high_44 (Length: 246)

Name: NF1429_high_44
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1429_high_44
NF1429_high_44
[»] chr2 (2 HSPs)
chr2 (1-230)||(44267006-44267236)
chr2 (72-149)||(5133655-5133733)
[»] chr6 (2 HSPs)
chr6 (71-104)||(32843423-32843456)
chr6 (72-149)||(33068670-33068747)
[»] chr4 (2 HSPs)
chr4 (71-104)||(9843774-9843807)
chr4 (72-104)||(19422347-19422379)
[»] chr3 (1 HSPs)
chr3 (72-104)||(24158611-24158643)


Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 44267006 - 44267236
Alignment:
1 aaactattttcagcttctctctataagttgttcatgataatttgtgaaaacagtttggctatannnnnnn-attatagaaataacttatacataagcagt 99  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||    
44267006 aaactattttcagcttctctctataagttgttcatgataatttgtgaaaacagtttggctatattttttttattatagaaataacttatacataagcagt 44267105  T
100 tatatatgcgcttatgcaatagtaaacatttaattaagttgtttatccaatgtagtcttttatattagaattagagaaatcacactagttttggcaatca 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44267106 tatatatgcgcttatgcaatagtaaacatttaattaagttgtttatccaatgtagtcttttatattagaattagagaaatcacactagttttggcaatca 44267205  T
200 acacttgccacaaaatgatggaaactggaag 230  Q
    |||||||||||||||||||||||||||||||    
44267206 acacttgccacaaaatgatggaaactggaag 44267236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 72 - 149
Target Start/End: Complemental strand, 5133733 - 5133655
Alignment:
72 ttatagaaataacttatacataagcagttat-atatgcgcttatgcaatagtaaacatttaattaagttgtttatccaa 149  Q
    ||||||||||| ||||||||||||||  ||| ||| | |||||||| ||| |||||| ||||||||| |||||||||||    
5133733 ttatagaaatagcttatacataagcaaatatgataagtgcttatgctataataaacacttaattaagctgtttatccaa 5133655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 71 - 104
Target Start/End: Original strand, 32843423 - 32843456
Alignment:
71 attatagaaataacttatacataagcagttatat 104  Q
    ||||||||||||||||||||||||||| ||||||    
32843423 attatagaaataacttatacataagcacttatat 32843456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 149
Target Start/End: Original strand, 33068670 - 33068747
Alignment:
72 ttatagaaataacttatacataagcagttat---atatgcgcttatgcaatagtaaacatttaattaagttgtttatccaa 149  Q
    |||||||||||||||||||||||||| ||||   ||| |||||||||| |   |||||| ||||||||| |||| ||||||    
33068670 ttatagaaataacttatacataagcatttatttgataagcgcttatgcta---taaacacttaattaagctgttcatccaa 33068747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 71 - 104
Target Start/End: Original strand, 9843774 - 9843807
Alignment:
71 attatagaaataacttatacataagcagttatat 104  Q
    |||||||||||| |||||||||||||||||||||    
9843774 attatagaaatagcttatacataagcagttatat 9843807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 104
Target Start/End: Complemental strand, 19422379 - 19422347
Alignment:
72 ttatagaaataacttatacataagcagttatat 104  Q
    |||||||||||||||||||||||||| ||||||    
19422379 ttatagaaataacttatacataagcatttatat 19422347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 104
Target Start/End: Original strand, 24158611 - 24158643
Alignment:
72 ttatagaaataacttatacataagcagttatat 104  Q
    |||||||||||||||||||||||||| ||||||    
24158611 ttatagaaataacttatacataagcacttatat 24158643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 176139 times since January 2019
Visitors: 2680