View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_high_49 (Length: 237)

Name: NF1429_high_49
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1429_high_49
[»] chr7 (3 HSPs)
chr7 (1-221)||(327602-327829)
chr7 (1-217)||(620767-620990)
chr7 (72-204)||(528434-528566)

Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr7

Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 327829 - 327602
1 tccaactttctgtaaattacttcattttgccgtttcattgctaggaatctccaaaagc-------cacgcacaggggaggaaagtggtatcgagagaaga 93  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||| |||||||||||||||||||||||||||||||    
327829 tccaactttctgtaaattacttcattttgccgtttcattgctaggaatctccaaaagcgtgtggtcacacacaggggaggaaagtggtatcgagagaaga 327730  T
94 ggcagtcatgtgaatcaaagatgcggttgatgccagaaatgagagtggatctgatattgtgattgtggctcgcaccgatgcgcgccaagccctgtctctt 193  Q
327729 ggcagtcatgtgaatcaaagatgcggttgatgccagaaatgagagtggatctgatattgtgattgtggctcgcaccgatgcgcgccaagccctgtctctt 327630  T
194 gatgaggcactctataggtcaaggacat 221  Q
327629 gatgaggcactctataggtcaaggacat 327602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 620767 - 620990
1 tccaactttctgtaaattacttcattttgccgtttcattgctaggaatctccaaaagc-------cacgcacaggggaggaaagtggtatcgagagaaga 93  Q
    |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||       ||| |||||||||||||||||||||||||||||||    
620767 tccaactttctgtaaattacttcattttgctgtttcattgctaggtatctccaaaagcgtgtggtcacacacaggggaggaaagtggtatcgagagaaga 620866  T
94 ggcagtcatgtgaatcaaagatgcggttgatgccagaaatgagagtggatctgatattgtgattgtggctcgcaccgatgcgcgccaagccctgtctctt 193  Q
    |||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
620867 ggcagtcatgcgaatcaaagctgcggttgatgccagaaatgagagtggatctgatattgtgattgtggctcgcaccgatgcgcgccaagccctgtctctt 620966  T
194 gatgaggcactctataggtcaagg 217  Q
620967 gatgaggcactctataggtcaagg 620990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 72 - 204
Target Start/End: Original strand, 528434 - 528566
72 ggaaagtggtatcgagagaagaggcagtcatgtgaatcaaagatgcggttgatgccagaaatgagagtggatctgatattgtgattgtggctcgcaccga 171  Q
    |||||||||| |||||||| ||||| || ||| |||| ||||  || |||||||| |||| ||||||||||||||||||||||||||||||||||| |||    
528434 ggaaagtggtgtcgagagaggaggcggttatgagaattaaagcggcagttgatgctagaagtgagagtggatctgatattgtgattgtggctcgcagcga 528533  T
172 tgcgcgccaagccctgtctcttgatgaggcact 204  Q
    ||| ||||||| | |||||||||| ||||||||    
528534 tgcacgccaaggcgtgtctcttgaagaggcact 528566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 175518 times since January 2019
Visitors: 2677