View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_high_5 (Length: 574)

Name: NF1429_high_5
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1429_high_5
[»] chr4 (1 HSPs)
chr4 (13-558)||(52141163-52141709)
[»] chr2 (1 HSPs)
chr2 (495-558)||(17808099-17808162)

Alignment Details
Target: chr4 (Bit Score: 497; Significance: 0; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 497; E-Value: 0
Query Start/End: Original strand, 13 - 558
Target Start/End: Original strand, 52141163 - 52141709
13 aaggtaagtaggtaactaaaaactgtatttaacattcattttcatttgaatgatttcaagtaactcatgcatgaatatgataatgcagaagcctagttca 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
52141163 aaggtaagtaggtaactaaaaactgtatttaacattcattttcatttgaatgatatcaagtaactcatgcatgaatatgataatgcagaagcctagttca 52141262  T
113 gcaatgaaggaattgatttccaaacaagttgtgcaaaccaagcaaatgatttccaaacaagccgttaaaatcgtgaaacgagcagaagaacacgaaaagc 212  Q
52141263 gcaatgaaggaattgatttccaaacaagttgtgcaaaccaagcaaatgatttccaaacaagccgttaaaatcgtgaaacgagcagaagaacacgaaaagc 52141362  T
213 tcatggccaaggtttcttttcagttcttgcttacaattaatatcattcnnnnnnnnnn-cttttcagaataaacaacattcttatgctgatttgttgatt 311  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||           |||||||||||||||||||||||||||||||||||||||||    
52141363 tcatcgccaaggtttcttttcagttcttgcttacaattaatatcattctttttttttttcttttcagaataaacaacattcttatgctgatttgttgatt 52141462  T
312 ttataacaaatctttttcaggtcactcatcttgtgggggttcttggttatggtagcttctgctttctcttggcagcaagtaagtgttaatctctttcaat 411  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
52141463 ttataacaaatctttttcaggtcactcatcttgtgggggttcttggttatggtagcttctgctttctcttgggagcaagtaagtgttaatctctttcaat 52141562  T
412 gtttttctttggaatcgattaattcatatatagtttcttttttcactctctttgaatgttcaggaccccaagacattccctatgtgtattgtttgttcta 511  Q
52141563 gtttttctttggaatcgattaattcatatatagtttcttttttcactctctttgaatgttcaggaccccaagacattccctatgtgtattgtttgttcta 52141662  T
512 cgtcttctttgttcctcttcgttggatttactataagttcaagaaat 558  Q
52141663 cgtcttctttgttcctcttcgttggatttactataagttcaagaaat 52141709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 495 - 558
Target Start/End: Complemental strand, 17808162 - 17808099
495 gtgtattgtttgttctacgtcttctttgttcctcttcgttggatttactataagttcaagaaat 558  Q
    |||||||||||||||||| |  | |||||||||||||||||||| |||||||  ||||||||||    
17808162 gtgtattgtttgttctactttgtgtttgttcctcttcgttggatatactatagattcaagaaat 17808099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 111553 times since January 2019
Visitors: 1375