View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_high_5 (Length: 574)

Name: NF1429_high_5
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1429_high_5
NF1429_high_5
[»] chr4 (1 HSPs)
chr4 (13-558)||(52141163-52141709)
[»] chr2 (1 HSPs)
chr2 (495-558)||(17808099-17808162)


Alignment Details
Target: chr4 (Bit Score: 497; Significance: 0; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 497; E-Value: 0
Query Start/End: Original strand, 13 - 558
Target Start/End: Original strand, 52141163 - 52141709
Alignment:
13 aaggtaagtaggtaactaaaaactgtatttaacattcattttcatttgaatgatttcaagtaactcatgcatgaatatgataatgcagaagcctagttca 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
52141163 aaggtaagtaggtaactaaaaactgtatttaacattcattttcatttgaatgatatcaagtaactcatgcatgaatatgataatgcagaagcctagttca 52141262  T
113 gcaatgaaggaattgatttccaaacaagttgtgcaaaccaagcaaatgatttccaaacaagccgttaaaatcgtgaaacgagcagaagaacacgaaaagc 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52141263 gcaatgaaggaattgatttccaaacaagttgtgcaaaccaagcaaatgatttccaaacaagccgttaaaatcgtgaaacgagcagaagaacacgaaaagc 52141362  T
213 tcatggccaaggtttcttttcagttcttgcttacaattaatatcattcnnnnnnnnnn-cttttcagaataaacaacattcttatgctgatttgttgatt 311  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||           |||||||||||||||||||||||||||||||||||||||||    
52141363 tcatcgccaaggtttcttttcagttcttgcttacaattaatatcattctttttttttttcttttcagaataaacaacattcttatgctgatttgttgatt 52141462  T
312 ttataacaaatctttttcaggtcactcatcttgtgggggttcttggttatggtagcttctgctttctcttggcagcaagtaagtgttaatctctttcaat 411  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
52141463 ttataacaaatctttttcaggtcactcatcttgtgggggttcttggttatggtagcttctgctttctcttgggagcaagtaagtgttaatctctttcaat 52141562  T
412 gtttttctttggaatcgattaattcatatatagtttcttttttcactctctttgaatgttcaggaccccaagacattccctatgtgtattgtttgttcta 511  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52141563 gtttttctttggaatcgattaattcatatatagtttcttttttcactctctttgaatgttcaggaccccaagacattccctatgtgtattgtttgttcta 52141662  T
512 cgtcttctttgttcctcttcgttggatttactataagttcaagaaat 558  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
52141663 cgtcttctttgttcctcttcgttggatttactataagttcaagaaat 52141709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 495 - 558
Target Start/End: Complemental strand, 17808162 - 17808099
Alignment:
495 gtgtattgtttgttctacgtcttctttgttcctcttcgttggatttactataagttcaagaaat 558  Q
    |||||||||||||||||| |  | |||||||||||||||||||| |||||||  ||||||||||    
17808162 gtgtattgtttgttctactttgtgtttgttcctcttcgttggatatactatagattcaagaaat 17808099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 216899 times since January 2019
Visitors: 2908