View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_high_51 (Length: 234)

Name: NF1429_high_51
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1429_high_51
NF1429_high_51
[»] chr4 (2 HSPs)
chr4 (1-223)||(1159482-1159724)
chr4 (68-100)||(1163612-1163644)


Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 1159724 - 1159482
Alignment:
1 cctacagtttataaataaagaagataatttatctcatcttcaagtaataatatgacctatgtcttgcttgggaggtcaattttctcacttttatagtaaa 100  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||| |||||  ||||||||||||||||||||||||||||||||||||||||||    
1159724 cctacaatttataaataaagaagataatttatctcatcttcaagtaataagatgac--atgtcttgcttgggaggtcaattttctcacttttatagtaaa 1159627  T
101 gttaaaccctagttgtaacaaac----aaatagagatatacttat------------------tgtataaaaccatttgcaagagatctccactgcacat 178  Q
    |||||||||||||||||||||||    ||||||| |||||  |||                  |||||||||||||||||||||||||||||||||||||    
1159626 gttaaaccctagttgtaacaaacaaacaaatagatatatatatatatatatatatatattttttgtataaaaccatttgcaagagatctccactgcacat 1159527  T
179 atatcagtatcatcattgttggtggttgaaacttagtagtaattg 223  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
1159526 atatcagtatcatcattgttggtggttgaaacttagtagtaattg 1159482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 68 - 100
Target Start/End: Complemental strand, 1163644 - 1163612
Alignment:
68 ttgggaggtcaattttctcacttttatagtaaa 100  Q
    |||||||||||||||| ||||||||||||||||    
1163644 ttgggaggtcaattttttcacttttatagtaaa 1163612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 216691 times since January 2019
Visitors: 2908