View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_high_52 (Length: 233)

Name: NF1429_high_52
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1429_high_52
[»] chr5 (17 HSPs)
chr5 (1-218)||(42228047-42228258)
chr5 (138-218)||(42228302-42228382)
chr5 (34-110)||(39594848-39594924)
chr5 (58-129)||(10640018-10640089)
chr5 (55-110)||(11064728-11064783)
chr5 (55-129)||(11700224-11700298)
chr5 (42-129)||(12425620-12425709)
chr5 (79-133)||(19460256-19460310)
chr5 (34-93)||(499702-499760)
chr5 (60-107)||(16457935-16457982)
chr5 (55-110)||(41419381-41419436)
chr5 (60-110)||(9107157-9107207)
chr5 (57-110)||(12433126-12433179)
chr5 (34-91)||(39105505-39105562)
chr5 (65-110)||(39248170-39248215)
chr5 (34-98)||(1464985-1465049)
chr5 (55-107)||(29925903-29925955)
[»] chr8 (11 HSPs)
chr8 (34-127)||(32840922-32841015)
chr8 (58-129)||(27028896-27028967)
chr8 (34-96)||(33808344-33808406)
chr8 (65-129)||(30251388-30251452)
chr8 (60-110)||(26771332-26771382)
chr8 (59-100)||(10722689-10722730)
chr8 (65-110)||(28763440-28763485)
chr8 (34-110)||(1930076-1930152)
chr8 (58-129)||(1058011-1058082)
chr8 (72-107)||(26215538-26215573)
chr8 (59-111)||(27754469-27754521)
[»] chr1 (9 HSPs)
chr1 (34-96)||(47498806-47498868)
chr1 (60-110)||(49938814-49938864)
chr1 (60-129)||(2295163-2295232)
chr1 (36-129)||(38001639-38001731)
chr1 (34-110)||(6102195-6102270)
chr1 (34-86)||(38503442-38503494)
chr1 (65-110)||(9572054-9572099)
chr1 (76-129)||(33204328-33204381)
chr1 (60-129)||(50644189-50644258)
[»] chr4 (6 HSPs)
chr4 (65-110)||(21731609-21731654)
chr4 (64-110)||(49940120-49940166)
chr4 (60-109)||(39603124-39603173)
chr4 (60-129)||(54426110-54426179)
chr4 (65-129)||(25904157-25904221)
chr4 (58-110)||(56249588-56249640)
[»] chr7 (8 HSPs)
chr7 (36-100)||(36537951-36538014)
chr7 (68-110)||(19214359-19214401)
chr7 (65-110)||(48470116-48470161)
chr7 (66-129)||(27863659-27863722)
chr7 (37-91)||(87047-87101)
chr7 (34-100)||(20526487-20526553)
chr7 (59-100)||(29574589-29574630)
chr7 (77-129)||(45338537-45338589)
[»] chr3 (6 HSPs)
chr3 (34-110)||(21367708-21367784)
chr3 (35-129)||(402476-402570)
chr3 (65-100)||(34637948-34637983)
chr3 (60-110)||(31365141-31365191)
chr3 (65-110)||(22919-22964)
chr3 (66-110)||(43046738-43046782)
[»] chr2 (8 HSPs)
chr2 (42-110)||(40682348-40682416)
chr2 (60-111)||(24100995-24101046)
chr2 (58-129)||(449912-449983)
chr2 (60-110)||(7035520-7035570)
chr2 (59-100)||(1801733-1801774)
chr2 (60-100)||(23974456-23974496)
chr2 (58-110)||(42419858-42419910)
chr2 (34-110)||(42457989-42458065)
[»] scaffold0024 (1 HSPs)
scaffold0024 (34-99)||(27617-27681)
[»] scaffold0057 (1 HSPs)
scaffold0057 (58-110)||(24686-24738)
[»] chr6 (1 HSPs)
chr6 (34-110)||(2455300-2455376)

Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 17)
Name: chr5

Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 42228047 - 42228258
1 catatttgaagcttatagcacaagcgctgacgtataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcac 100  Q
42228047 catatttgaagcttatagcacaagcgctgacgtataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcac 42228146  T
101 gaaacttatgagagtggataacctcaaatgagcgaactaaaagcttgaatttttacaagaatttccatcaacccattacaatgcgaccaattgggtagct 200  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||     ||||||||| |||||    
42228147 gaaacttatgagagtggataacctcaaatgag-gaactaaaagcttgaatttttacaagaatttccatcaacccattaca-----accaattggttagct 42228240  T
201 aaatttgaactcaattat 218  Q
42228241 aaatttgaactcaattat 42228258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 138 - 218
Target Start/End: Original strand, 42228302 - 42228382
138 taaaagcttgaatttttacaagaatttccatcaacccattacaatgcgaccaattgggtagctaaatttgaactcaattat 218  Q
    |||||||||||||||||||| ||| |||||||||||||||||||| | |||||||||||| ||||||| |||||| |||||    
42228302 taaaagcttgaatttttacacgaacttccatcaacccattacaattcaaccaattgggtatctaaattagaactcgattat 42228382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 34 - 110
Target Start/End: Original strand, 39594848 - 39594924
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||| ||||||||||| ||||| | |||| |||||||| |||||||| ||||||||||||| || |||||||||    
39594848 ataagctgaaaacaacttaataacattatcttcagctgttttcataagttgtcccaaacaatctaacaaaacttatg 39594924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 58 - 129
Target Start/End: Original strand, 10640018 - 10640089
58 aatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    |||||| |||||||||| |||||||||||||||||||| |||| |||||||||  ||| ||||| |||||||    
10640018 aatgtcataagctgttttcataagttctcccaaacaatatcacaaaacttatgtcagtagataaactcaaat 10640089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 55 - 110
Target Start/End: Original strand, 11064728 - 11064783
55 aacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||||| |||||| ||| ||||||||||| ||||||||||||| |||||||||    
11064728 aacaatgtcataagctattttcataagttctctcaaacaatctcacaaaacttatg 11064783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 55 - 129
Target Start/End: Original strand, 11700224 - 11700298
55 aacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    ||||||||| |||| ||||||||||||||||   ||||| |||||| |||||||||  ||||||||| |||||||    
11700224 aacaatgtcataagttgtttccataagttctgtgaaacagtctcacaaaacttatgccagtggataagctcaaat 11700298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 42 - 129
Target Start/End: Original strand, 12425620 - 12425709
42 aaaacaacttactaacaatgtcttaagctgtttccata--agttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    ||||||||||| | ||||||| ||| | ||||| ||||  |||||||||||||| |||||| |||||||||| ||| ||||| |||||||    
12425620 aaaacaacttattgacaatgttttaggttgttttcatataagttctcccaaacagtctcacaaaacttatgacagtagataagctcaaat 12425709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 79 - 133
Target Start/End: Complemental strand, 19460310 - 19460256
79 aagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaatgagc 133  Q
    |||||||||||||||||||||| |||||||||  ||| ||||| |||||||||||    
19460310 aagttctcccaaacaatctcactaaacttatgccagtagataaactcaaatgagc 19460256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 34 - 93
Target Start/End: Complemental strand, 499760 - 499702
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaaca 93  Q
    ||||||| ||||||||||  ||||| |||| |||||||||| ||||||||||||||||||    
499760 ataagctgaaaacaacttgttaaca-tgtcataagctgttttcataagttctcccaaaca 499702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 60 - 107
Target Start/End: Complemental strand, 16457982 - 16457935
60 tgtcttaagctgtttccataagttctcccaaacaatctcacgaaactt 107  Q
    |||| |||||||||| |||||||||||||||||| |||||| ||||||    
16457982 tgtcataagctgttttcataagttctcccaaacagtctcacaaaactt 16457935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 55 - 110
Target Start/End: Original strand, 41419381 - 41419436
55 aacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||||| |||||||||| || ||||| |||||||||||||||| ||| |||||    
41419381 aacaatgtcataagctgttttcacaagttatcccaaacaatctcacaaaatttatg 41419436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 60 - 110
Target Start/End: Original strand, 9107157 - 9107207
60 tgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||| |||||||||| ||| |||||||||||||| |||||| |||||||||    
9107157 tgtcctaagctgttttcatgagttctcccaaacattctcacaaaacttatg 9107207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 110
Target Start/End: Complemental strand, 12433179 - 12433126
57 caatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||| |||||| ||| ||||| ||||||||||||||||||| |||| ||||    
12433179 caatgtcgtaagctattttcataacttctcccaaacaatctcacaaaacctatg 12433126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 34 - 91
Target Start/End: Original strand, 39105505 - 39105562
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaa 91  Q
    |||||||||||| | ||||  ||||||||| |||||||||| ||||| ||||||||||    
39105505 ataagctaaaaatagcttatgaacaatgtcataagctgttttcataaattctcccaaa 39105562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 110
Target Start/End: Original strand, 39248170 - 39248215
65 taagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||||||  ||||||||||||||||| |||||| |||||||||    
39248170 taagctgtttttataagttctcccaaacagtctcacaaaacttatg 39248215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 34 - 98
Target Start/End: Complemental strand, 1465049 - 1464985
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctc 98  Q
    ||||||| |||||||||||  | ||||| | |||||||||| ||||||||||||| |||| ||||    
1465049 ataagctgaaaacaacttatgagcaatgccataagctgttttcataagttctcccgaacagtctc 1464985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 107
Target Start/End: Original strand, 29925903 - 29925955
55 aacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaactt 107  Q
    |||| |||| |||||||||| |||||||||||||||||  |||||| ||||||    
29925903 aacattgtcataagctgttttcataagttctcccaaacggtctcacaaaactt 29925955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 11)
Name: chr8

Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 34 - 127
Target Start/End: Complemental strand, 32841015 - 32840922
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaa 127  Q
    ||||||| |||||||||||  ||||||||| |||| ||||| |||||||||||||||||| |||| | |||||| || |||| ||||| |||||    
32841015 ataagctgaaaacaacttatgaacaatgtcataagttgttttcataagttctcccaaacagtctcgcaaaacttgtgtgagtagataagctcaa 32840922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 58 - 129
Target Start/End: Original strand, 27028896 - 27028967
58 aatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    |||||| |||||||||| || || ||||||||||||||||||| |||||||||  ||||||||| |||||||    
27028896 aatgtcctaagctgttttcagaatttctcccaaacaatctcactaaacttatgccagtggataaactcaaat 27028967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 34 - 96
Target Start/End: Original strand, 33808344 - 33808406
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatc 96  Q
    |||||||||||||||||||  |||||| || |||||| ||| |||||||||||||||||||||    
33808344 ataagctaaaaacaacttatgaacaatatcataagctattttcataagttctcccaaacaatc 33808406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 65 - 129
Target Start/End: Complemental strand, 30251452 - 30251388
65 taagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    |||||||||| | |||||||||||||||| ||||||||||||||||  ||| ||||| |||||||    
30251452 taagctgttttcgtaagttctcccaaacagtctcacgaaacttatgtcagtagataagctcaaat 30251388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 60 - 110
Target Start/End: Original strand, 26771332 - 26771382
60 tgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||| |||||||||| |||||||||||||||||| |||||| |||||||||    
26771332 tgtcataagctgttttcataagttctcccaaacagtctcacaaaacttatg 26771382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 59 - 100
Target Start/End: Original strand, 10722689 - 10722730
59 atgtcttaagctgtttccataagttctcccaaacaatctcac 100  Q
    ||||| |||||||||||||||| |||||||||||||||||||    
10722689 atgtcataagctgtttccataaattctcccaaacaatctcac 10722730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 65 - 110
Target Start/End: Original strand, 28763440 - 28763485
65 taagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||||||||| |||||||||||||||||| |||||| |||||||||    
28763440 taagctgttttcataagttctcccaaacagtctcacaaaacttatg 28763485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 34 - 110
Target Start/End: Original strand, 1930076 - 1930152
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||| |||||| ||||  ||||||||| ||| |||||| || ||||||||||||| ||| |||| |||||||||    
1930076 ataagctgaaaacagcttatgaacaatgtcataaactgttttcacaagttctcccaaataatgtcacaaaacttatg 1930152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 58 - 129
Target Start/End: Complemental strand, 1058082 - 1058011
58 aatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    |||||| ||||| |||| || ||||||||||||||| |||||| |||||||||  ||| ||||| |||||||    
1058082 aatgtcataagcagttttcaaaagttctcccaaacagtctcacaaaacttatgtaagtagataagctcaaat 1058011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 72 - 107
Target Start/End: Original strand, 26215538 - 26215573
72 tttccataagttctcccaaacaatctcacgaaactt 107  Q
    ||||||||||||||||||||||||||||| ||||||    
26215538 tttccataagttctcccaaacaatctcacaaaactt 26215573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 59 - 111
Target Start/End: Original strand, 27754469 - 27754521
59 atgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatga 111  Q
    ||||| ||| |||||| |||||||||||||||| | |||||| ||||||||||    
27754469 atgtcataaactgttttcataagttctcccaaatagtctcacaaaacttatga 27754521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 9)
Name: chr1

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 34 - 96
Target Start/End: Complemental strand, 47498868 - 47498806
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatc 96  Q
    |||||||||||||||||||  |||||| || |||||| ||| |||||||||||||||||||||    
47498868 ataagctaaaaacaacttatgaacaatatcataagctattttcataagttctcccaaacaatc 47498806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 60 - 110
Target Start/End: Original strand, 49938814 - 49938864
60 tgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||| |||||||||| ||||||||||||||||||||||||| |||||||||    
49938814 tgtcataagctgttttcataagttctcccaaacaatctcacaaaacttatg 49938864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 60 - 129
Target Start/End: Original strand, 2295163 - 2295232
60 tgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    |||| |||||||||| |||||||||||||||||| |||||| |||||||||  ||| ||||| |||||||    
2295163 tgtcataagctgttttcataagttctcccaaacagtctcacaaaacttatgccagtagataagctcaaat 2295232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 36 - 129
Target Start/End: Original strand, 38001639 - 38001731
36 aagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    ||||| |||||||||||  ||||  ||| |||||||||| |||||||||||||||||| |||||| |||||||||  ||| ||||| |||||||    
38001639 aagctgaaaacaacttatgaacag-gtcataagctgttttcataagttctcccaaacagtctcacaaaacttatgtcagttgataaactcaaat 38001731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 34 - 110
Target Start/End: Original strand, 6102195 - 6102270
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||| ||||||| |||  |||||| || |||||||||| |||| |||||||||||||||||||| ||| |||||    
6102195 ataagctgaaaacaatttatgaacaatatcataagctgttttcata-gttctcccaaacaatctcacaaaatttatg 6102270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 34 - 86
Target Start/End: Complemental strand, 38503494 - 38503442
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctc 86  Q
    ||||||| |||||||||||  ||||||||| || |||||||||||||||||||    
38503494 ataagctgaaaacaacttatgaacaatgtcataggctgtttccataagttctc 38503442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 110
Target Start/End: Complemental strand, 9572099 - 9572054
65 taagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||||||||| |||||||||||||||||| |||||| || ||||||    
9572099 taagctgttttcataagttctcccaaacagtctcacaaatcttatg 9572054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 76 - 129
Target Start/End: Complemental strand, 33204381 - 33204328
76 cataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    |||||||||||||||||| |||||| |||||||||  ||| ||||| |||||||    
33204381 cataagttctcccaaacagtctcacaaaacttatgtcagtagataagctcaaat 33204328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 60 - 129
Target Start/End: Complemental strand, 50644258 - 50644189
60 tgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    |||| |||| ||||| |||||||||||||||||| |||||| |||| ||||  ||| ||||| |||||||    
50644258 tgtcgtaagttgttttcataagttctcccaaacagtctcacaaaacatatgttagtagataagctcaaat 50644189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 6)
Name: chr4

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 65 - 110
Target Start/End: Complemental strand, 21731654 - 21731609
65 taagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||||||||| ||||||||||||||||||||||||| |||||||||    
21731654 taagctgttttcataagttctcccaaacaatctcacaaaacttatg 21731609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 110
Target Start/End: Complemental strand, 49940166 - 49940120
64 ttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||||||| ||||||||||| |||||| |||||| |||||||||    
49940166 ttaagctgttttcataagttctctcaaacagtctcacaaaacttatg 49940120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 60 - 109
Target Start/End: Complemental strand, 39603173 - 39603124
60 tgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttat 109  Q
    |||| |||||||||| | |||||||||||||||| |||||| ||||||||    
39603173 tgtcataagctgttttcctaagttctcccaaacagtctcacaaaacttat 39603124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 60 - 129
Target Start/End: Original strand, 54426110 - 54426179
60 tgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    |||| |||||||||| | ||||||||||||| || |||||| |||||||||  ||| ||||| |||||||    
54426110 tgtcataagctgttttcctaagttctcccaagcagtctcacaaaacttatgccagtagataagctcaaat 54426179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 129
Target Start/End: Complemental strand, 25904221 - 25904157
65 taagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    |||||||||| |||||| ||||||||||| |||||| ||| |||||  | ||||||| |||||||    
25904221 taagctgttttcataagctctcccaaacagtctcacaaaatttatgtcattggataagctcaaat 25904157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 110
Target Start/End: Original strand, 56249588 - 56249640
58 aatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||||| ||||||||||  ||||||| | |||||||||||||| |||||||||    
56249588 aatgtcataagctgttttgataagttgttccaaacaatctcacaaaacttatg 56249640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 8)
Name: chr7

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 36 - 100
Target Start/End: Original strand, 36537951 - 36538014
36 aagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcac 100  Q
    |||||||||||||||||  |||| |||| |||| ||||||||||||||||| |||||||||||||    
36537951 aagctaaaaacaacttatgaaca-tgtcataagttgtttccataagttctctcaaacaatctcac 36538014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 68 - 110
Target Start/End: Complemental strand, 19214401 - 19214359
68 gctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||| ||||||||||||||||||||||||| |||||||||    
19214401 gctgttttcataagttctcccaaacaatctcacaaaacttatg 19214359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 65 - 110
Target Start/End: Original strand, 48470116 - 48470161
65 taagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||||||||| ||||||||||||||||||||||||  |||||||||    
48470116 taagctgttttcataagttctcccaaacaatctcataaaacttatg 48470161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 66 - 129
Target Start/End: Complemental strand, 27863722 - 27863659
66 aagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    ||||||||| ||||||||||| |||| | |||||| |||||||||  ||||||||| |||||||    
27863722 aagctgttttcataagttctctcaaatagtctcacaaaacttatgccagtggataagctcaaat 27863659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 37 - 91
Target Start/End: Original strand, 87047 - 87101
37 agctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaa 91  Q
    |||| ||||||||||||||||||| || |||||| ||||  ||||||||||||||    
87047 agctgaaaacaacttactaacaatatcataagctttttctgtaagttctcccaaa 87101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 34 - 100
Target Start/End: Original strand, 20526487 - 20526553
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcac 100  Q
    |||||||||||||| ||||| || |||||  ||| |||||| ||||||||||| |||||| ||||||    
20526487 ataagctaaaaacagcttacgaaaaatgtgataaactgttttcataagttctctcaaacagtctcac 20526553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 59 - 100
Target Start/End: Complemental strand, 29574630 - 29574589
59 atgtcttaagctgtttccataagttctcccaaacaatctcac 100  Q
    ||||| ||||||||||||||||||||||| ||||| ||||||    
29574630 atgtcataagctgtttccataagttctccgaaacagtctcac 29574589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 77 - 129
Target Start/End: Original strand, 45338537 - 45338589
77 ataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    ||||||||||||||||| |||||  |||||||||  ||||||||| |||||||    
45338537 ataagttctcccaaacagtctcaaaaaacttatgctagtggataaactcaaat 45338589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 37; Significance: 0.000000000005; HSPs: 6)
Name: chr3

Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 34 - 110
Target Start/End: Original strand, 21367708 - 21367784
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||| |||||| |||   ||||||||| |||||||||| |||||||||||||||||| || ||| |||||||||    
21367708 ataagctgaaaacagcttgtgaacaatgtcataagctgttttcataagttctcccaaacagtcccacaaaacttatg 21367784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 129
Target Start/End: Complemental strand, 402570 - 402476
35 taagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    |||||| |||||| ||||  ||||||||| |||||||||| |||| ||||||||||||| |||  | |||||||||  ||| ||||| |||||||    
402570 taagctgaaaacagcttatgaacaatgtcataagctgttttcatacgttctcccaaacagtcttgcaaaacttatgttagttgataaactcaaat 402476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 100
Target Start/End: Complemental strand, 34637983 - 34637948
65 taagctgtttccataagttctcccaaacaatctcac 100  Q
    |||||||||| |||||||||||||||||||||||||    
34637983 taagctgttttcataagttctcccaaacaatctcac 34637948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 60 - 110
Target Start/End: Complemental strand, 31365191 - 31365141
60 tgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||| ||||||| || |||||||||||||||||| |||||| |||||||||    
31365191 tgtcataagctgctttcataagttctcccaaacagtctcacaaaacttatg 31365141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 110
Target Start/End: Complemental strand, 22964 - 22919
65 taagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||||||||| ||||| |||||| |||||||||||| |||||||||    
22964 taagctgttttcataacttctcctaaacaatctcacaaaacttatg 22919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 66 - 110
Target Start/End: Original strand, 43046738 - 43046782
66 aagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||||| |||||||||||||||||| |||||| |||| ||||    
43046738 aagctgttttcataagttctcccaaacagtctcacaaaacatatg 43046782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 8)
Name: chr2

Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 40682416 - 40682348
42 aaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||||||||||  ||||||||| |||||| |||  | |||||||||||||||||||||| |||||||||    
40682416 aaaacaacttatgaacaatgtcataagctattttaacaagttctcccaaacaatctcacaaaacttatg 40682348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 60 - 111
Target Start/End: Original strand, 24100995 - 24101046
60 tgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatga 111  Q
    |||| |||| |||||||||||||||||||||||| |||||| ||||||||||    
24100995 tgtcataaggtgtttccataagttctcccaaacagtctcacaaaacttatga 24101046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 58 - 129
Target Start/End: Original strand, 449912 - 449983
58 aatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatgagagtggataacctcaaat 129  Q
    |||||| |||||||||| || |||| ||||||||||||||||  |||||||||  ||| ||||| |||||||    
449912 aatgtcataagctgttttcaaaagtcctcccaaacaatctcataaaacttatgctagtagataagctcaaat 449983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 60 - 110
Target Start/End: Complemental strand, 7035570 - 7035520
60 tgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||| ||||||||||||||||||||| | ||||| |||||| |||||||||    
7035570 tgtcataagctgtttccataagttcttcaaaacagtctcacaaaacttatg 7035520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 59 - 100
Target Start/End: Original strand, 1801733 - 1801774
59 atgtcttaagctgtttccataagttctcccaaacaatctcac 100  Q
    ||||| |||||||||| |||||||||||||||||||| ||||    
1801733 atgtcataagctgttttcataagttctcccaaacaatatcac 1801774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 60 - 100
Target Start/End: Complemental strand, 23974496 - 23974456
60 tgtcttaagctgtttccataagttctcccaaacaatctcac 100  Q
    |||| |||||||||| |||||||||||| ||||||||||||    
23974496 tgtcataagctgttttcataagttctccaaaacaatctcac 23974456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 110
Target Start/End: Original strand, 42419858 - 42419910
58 aatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||||| |||||||||| | |||||||||||||||| |||||  |||||||||    
42419858 aatgtcataagctgttttcgtaagttctcccaaacagtctcaaaaaacttatg 42419910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 34 - 110
Target Start/End: Original strand, 42457989 - 42458065
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||| ||||||||||| | | ||||| ||||| ||||| |||||  ||||| ||||| |||||| |||||||||    
42457989 ataagctgaaaacaacttattgaaaatgttttaagttgttttcataaactctcctaaacactctcacaaaacttatg 42458065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0024

Target: scaffold0024; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 34 - 99
Target Start/End: Original strand, 27617 - 27681
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctca 99  Q
    ||||||| ||||||||||| || | ||||| |||||| |||||||||| ||||||||||| |||||    
27617 ataagctgaaaacaactta-tagccatgtcataagctatttccataagctctcccaaacagtctca 27681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0057

Target: scaffold0057; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 110
Target Start/End: Original strand, 24686 - 24738
58 aatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    |||||| ||||||||||  ||||||||||||||||| |||||| |||| ||||    
24686 aatgtcataagctgttttgataagttctcccaaacagtctcacaaaacatatg 24738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 34 - 110
Target Start/End: Original strand, 2455300 - 2455376
34 ataagctaaaaacaacttactaacaatgtcttaagctgtttccataagttctcccaaacaatctcacgaaacttatg 110  Q
    ||||||| |||||||||||  ||||||||  |||| ||||| ||||||||||| |||| | | |||| |||||||||    
2455300 ataagctgaaaacaacttataaacaatgtaataagttgttttcataagttctctcaaatagtttcaccaaacttatg 2455376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 175413 times since January 2019
Visitors: 2677