View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_high_53 (Length: 226)

Name: NF1429_high_53
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1429_high_53
[»] chr5 (2 HSPs)
chr5 (10-226)||(32256795-32257012)
chr5 (10-213)||(32265610-32265814)
[»] chr1 (1 HSPs)
chr1 (10-72)||(23205426-23205488)
[»] chr8 (1 HSPs)
chr8 (118-185)||(3120844-3120912)

Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 2)
Name: chr5

Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 10 - 226
Target Start/End: Original strand, 32256795 - 32257012
10 aagagggactaaggaaggagaaatgctatgtttaatgtcttacgaaataaaaatatgagcttcnnnnnnnnnnn-tgaagcacaaatatgaaaatgagtt 108  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||            |||||||||||||||||||||||||    
32256795 aagagggaccaaggaaggagaaatgctatgtttaatgtcttacgaaataaaaaaatgagcttcgaaaaaaaaaaatgaagcacaaatatgaaaatgagtt 32256894  T
109 aagaaatagtattaccagtcaaagatgaagattgttgtaatgttgctgctgatttgatttggtgacttctccttaactttggaaaggaattgagaagaag 208  Q
    | ||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
32256895 atgaaatagtattgccaatcaaagatgaagattgttgtaatgttgctgctgatttgatttggtgacttctccttaactttggaaaggaattgagaagagg 32256994  T
209 cagaattatacaatgttc 226  Q
    |||||||||| |||||||    
32256995 cagaattatataatgttc 32257012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 10 - 213
Target Start/End: Original strand, 32265610 - 32265814
10 aagagggactaaggaaggagaaatgctatgtttaatgtcttacgaaataaaaatatgagcttcnnnnnnnnnnn-tgaagcacaaatatgaaaatgagtt 108  Q
    ||||||||| ||||||||||||||| |||||||||| ||| ||||||||||||||||| ||||            |||||||||||||||||||||||||    
32265610 aagagggaccaaggaaggagaaatgatatgtttaatctctaacgaaataaaaatatgaacttcaaaacaaaaaaatgaagcacaaatatgaaaatgagtt 32265709  T
109 aagaaatagtattaccagtcaaagatgaagattgttgtaatgttgctgctgatttgatttggtgacttctccttaactttggaaaggaattgagaagaag 208  Q
     |||||||||||||||| |||||||||| |||||||||||||||  ||||||||||||| |||||||| |||| ||||||||||||||||||||||||||    
32265710 tagaaatagtattaccactcaaagatgaggattgttgtaatgttcttgctgatttgattcggtgacttatcctcaactttggaaaggaattgagaagaag 32265809  T
209 cagaa 213  Q
32265810 cagaa 32265814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 10 - 72
Target Start/End: Original strand, 23205426 - 23205488
10 aagagggactaaggaaggagaaatgctatgtttaatgtcttacgaaataaaaatatgagcttc 72  Q
    ||||| ||| ||||||||||||||||| |||||||||||  |||| |||||||||||||||||    
23205426 aagagtgaccaaggaaggagaaatgctttgtttaatgtcaaacgagataaaaatatgagcttc 23205488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 118 - 185
Target Start/End: Complemental strand, 3120912 - 3120844
118 tattaccagtcaaagatgaagattgttgtaatgtt-gctgctgatttgatttggtgacttctccttaac 185  Q
    |||||||| ||| ||||||| |||| |||  |||| | |||||||||||||||| ||||||||||||||    
3120912 tattaccactcagagatgaaaattgatgttctgtttgttgctgatttgatttggagacttctccttaac 3120844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 175261 times since January 2019
Visitors: 2789