View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_high_53 (Length: 226)

Name: NF1429_high_53
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1429_high_53
NF1429_high_53
[»] chr5 (2 HSPs)
chr5 (10-226)||(32256795-32257012)
chr5 (10-213)||(32265610-32265814)
[»] chr1 (1 HSPs)
chr1 (10-72)||(23205426-23205488)
[»] chr8 (1 HSPs)
chr8 (118-185)||(3120844-3120912)


Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 10 - 226
Target Start/End: Original strand, 32256795 - 32257012
Alignment:
10 aagagggactaaggaaggagaaatgctatgtttaatgtcttacgaaataaaaatatgagcttcnnnnnnnnnnn-tgaagcacaaatatgaaaatgagtt 108  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||            |||||||||||||||||||||||||    
32256795 aagagggaccaaggaaggagaaatgctatgtttaatgtcttacgaaataaaaaaatgagcttcgaaaaaaaaaaatgaagcacaaatatgaaaatgagtt 32256894  T
109 aagaaatagtattaccagtcaaagatgaagattgttgtaatgttgctgctgatttgatttggtgacttctccttaactttggaaaggaattgagaagaag 208  Q
    | ||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
32256895 atgaaatagtattgccaatcaaagatgaagattgttgtaatgttgctgctgatttgatttggtgacttctccttaactttggaaaggaattgagaagagg 32256994  T
209 cagaattatacaatgttc 226  Q
    |||||||||| |||||||    
32256995 cagaattatataatgttc 32257012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 10 - 213
Target Start/End: Original strand, 32265610 - 32265814
Alignment:
10 aagagggactaaggaaggagaaatgctatgtttaatgtcttacgaaataaaaatatgagcttcnnnnnnnnnnn-tgaagcacaaatatgaaaatgagtt 108  Q
    ||||||||| ||||||||||||||| |||||||||| ||| ||||||||||||||||| ||||            |||||||||||||||||||||||||    
32265610 aagagggaccaaggaaggagaaatgatatgtttaatctctaacgaaataaaaatatgaacttcaaaacaaaaaaatgaagcacaaatatgaaaatgagtt 32265709  T
109 aagaaatagtattaccagtcaaagatgaagattgttgtaatgttgctgctgatttgatttggtgacttctccttaactttggaaaggaattgagaagaag 208  Q
     |||||||||||||||| |||||||||| |||||||||||||||  ||||||||||||| |||||||| |||| ||||||||||||||||||||||||||    
32265710 tagaaatagtattaccactcaaagatgaggattgttgtaatgttcttgctgatttgattcggtgacttatcctcaactttggaaaggaattgagaagaag 32265809  T
209 cagaa 213  Q
    |||||    
32265810 cagaa 32265814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 10 - 72
Target Start/End: Original strand, 23205426 - 23205488
Alignment:
10 aagagggactaaggaaggagaaatgctatgtttaatgtcttacgaaataaaaatatgagcttc 72  Q
    ||||| ||| ||||||||||||||||| |||||||||||  |||| |||||||||||||||||    
23205426 aagagtgaccaaggaaggagaaatgctttgtttaatgtcaaacgagataaaaatatgagcttc 23205488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 118 - 185
Target Start/End: Complemental strand, 3120912 - 3120844
Alignment:
118 tattaccagtcaaagatgaagattgttgtaatgtt-gctgctgatttgatttggtgacttctccttaac 185  Q
    |||||||| ||| ||||||| |||| |||  |||| | |||||||||||||||| ||||||||||||||    
3120912 tattaccactcagagatgaaaattgatgttctgtttgttgctgatttgatttggagacttctccttaac 3120844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175459 times since January 2019
Visitors: 2677