View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_high_54 (Length: 223)

Name: NF1429_high_54
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1429_high_54
[»] chr6 (1 HSPs)
chr6 (1-207)||(778389-778595)

Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 778595 - 778389
1 tctaaaagaatccatttttggatttgaaatgaagaaaggtgaagattttccaacagtttggaagaaagaagaagatggacatgcaaatccatcaatggtg 100  Q
778595 tctaaaagaatccatttttggatttgaaatgaagaaaggtgaagattttccaacagtttggaagaaagaagaagatggacatgcaaatccatcaatggtg 778496  T
101 agtctaagtggtgaagaagaaaaattgtgagaatgagaattttgaaaagggtgaaattttggtttggttatgtggtttgaaagatgtaaggttgaagaag 200  Q
778495 agtctaagtggtgaagaagaaaaattgtgagaatgagaattttgaaaagggtgaaattttggtttggttatgtggtttgaaagatgtaaggttgaagaag 778396  T
201 aaggtga 207  Q
778395 aaggtga 778389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 295695 times since January 2019
Visitors: 3016