View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_low_13 (Length: 463)

Name: NF1429_low_13
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1429_low_13
NF1429_low_13
[»] chr8 (1 HSPs)
chr8 (1-449)||(44883892-44884340)
[»] chr2 (5 HSPs)
chr2 (49-393)||(8994206-8994574)
chr2 (49-309)||(9028863-9029120)
chr2 (10-91)||(9019385-9019466)
chr2 (256-393)||(9007176-9007334)
chr2 (307-393)||(9029136-9029231)


Alignment Details
Target: chr8 (Bit Score: 429; Significance: 0; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 429; E-Value: 0
Query Start/End: Original strand, 1 - 449
Target Start/End: Complemental strand, 44884340 - 44883892
Alignment:
1 tgagtatgatcgtttgtcttcaaacccttctccttcaccttctcgactcagattgttcctcttcttctcaaaaccagatactgctgtttccatgggaaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44884340 tgagtatgatcgtttgtcttcaaacccttctccttcaccttctcgactcagattgttcctcttcttctcaaaaccagatactgctgtttccatgggaaat 44884241  T
101 ggtcacttttataatcatgcgtggtttgtggaagctctcaacaactcagggattctgtctcgtgttgtttcggattctgcagctgctgttgataactgcc 200  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
44884240 ggtcacttttataatcatgcatggtttgtggaagctctcaacaactcagggattctgtctcgtgttgtttcagattctgcagctgctgttgataactgcc 44884141  T
201 tcctcaacctcgatgattatgatattaatgcttcaagtaatgacgaaaatactaataataatgttatcaaggagcatttgattgatgttgattattcagt 300  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44884140 tcctcaacctcgatgattatgatattagtgcttcaagtaatgacgaaaatactaataataatgttatcaaggagcatttgattgatgttgattattcagt 44884041  T
301 gcctgtggaggaggaggaggagaagaacatgtttaattattcaattgctaatcttcgagttcgtgttgatcatgacgatgatggtagcggggcgaagcaa 400  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
44884040 gcctgtggaggaggaggaggagaagaacatgtttaattattcaattgctaatcttcgagttcgtgttgatcatgacgatgatggtagcggggtgaagcaa 44883941  T
401 gagcagaggcttaggatggaacaacagcatgataacaactttgataatg 449  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||    
44883940 gagcagaggcttaggatggaacaacagcatgaaaacaactttgataatg 44883892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 143; Significance: 6e-75; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 143; E-Value: 6e-75
Query Start/End: Original strand, 49 - 393
Target Start/End: Original strand, 8994206 - 8994574
Alignment:
49 cagattgttcctcttcttctcaaaaccagatactgctgtttccatgggaaatggtcacttttataatcatgcgtggtttgtggaagctctcaacaactca 148  Q
    |||||||||||| |||||||||||||||||||||| |||||||||||| |||| ||||||| ||||||||| |||||||||||||||||| ||||| |||    
8994206 cagattgttcctattcttctcaaaaccagatactgatgtttccatgggtaatgatcactttgataatcatgtgtggtttgtggaagctctgaacaaatca 8994305  T
149 gggattctgtctcgtgttgtttcggattctgcagctgctgttgataactgcctcctcaacctcgatgattatgatattaatgcttcaagtaatgacgaaa 248  Q
    |||||||| |||||||||||||| | |||||| || | ||| |||||||||||||||||||| |||||||||||| ||| ||||||||  ||||| ||||    
8994306 gggattctctctcgtgttgtttctgtttctgctgcggttgtggataactgcctcctcaaccttgatgattatgatgttagtgcttcaatcaatgatgaaa 8994405  T
249 atactaataataatgttatcaaggagcatttgattgatgttgattattcagtgcctgtgga------------------ggaggaggaggagaagaacat 330  Q
    |||||||||||   ||||  ||||||||||||||||||||||| |||||||| | ||||||                  ||| ||||||||| |||||||    
8994406 atactaataat---gttaaaaaggagcatttgattgatgttgactattcagttcttgtggatgatgatgatgaggaggaggaagaggaggaggagaacat 8994502  T
331 gtttaattattcaattgctaatc---------ttcgagttcgtgttgatcatgacgatgatggtagcggggc 393  Q
    ||||||||||||| |||||||||         |||||||||||||||||||||| || ||||||||||||||    
8994503 gtttaattattcagttgctaatcttcctgaaattcgagttcgtgttgatcatgatgacgatggtagcggggc 8994574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 143; E-Value: 6e-75
Query Start/End: Original strand, 49 - 309
Target Start/End: Original strand, 9028863 - 9029120
Alignment:
49 cagattgttcctcttcttctcaaaaccagatactgctgtttccatgggaaatggtcacttttataatcatgcgtggtttgtggaagctctcaacaactca 148  Q
    |||||||||||| |||||||||||||||||||||| |||||||||||| |||| ||||||| ||||||||| |||||||||||||||||| ||||| |||    
9028863 cagattgttcctattcttctcaaaaccagatactgatgtttccatgggtaatgatcactttgataatcatgtgtggtttgtggaagctctgaacaaatca 9028962  T
149 gggattctgtctcgtgttgtttcggattctgcagctgctgttgataactgcctcctcaacctcgatgattatgatattaatgcttcaagtaatgacgaaa 248  Q
    |||||||| |||||||||||||| | |||||| || | ||| |||||||||||||||||||| |||||||||||| ||| ||||||||  ||||| ||||    
9028963 gggattctctctcgtgttgtttctgtttctgctgcggttgtggataactgcctcctcaaccttgatgattatgatgttagtgcttcaatcaatgatgaaa 9029062  T
249 atactaataataatgttatcaaggagcatttgattgatgttgattattcagtgcctgtgga 309  Q
    ||||   |||||||||||  ||||||||||||||||||||||| |||||||| | ||||||    
9029063 atac---taataatgttaaaaaggagcatttgattgatgttgactattcagttcttgtgga 9029120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 10 - 91
Target Start/End: Original strand, 9019385 - 9019466
Alignment:
10 tcgtttgtcttcaaacccttctccttcaccttctcgactcagattgttcctcttcttctcaaaaccagatactgctgtttcc 91  Q
    |||||||||||||||||| |||||||| ||||||||||||||||||||| | ||| |||||||||||||||||||| |||||    
9019385 tcgtttgtcttcaaacccgtctccttccccttctcgactcagattgttcatgttcatctcaaaaccagatactgctatttcc 9019466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 256 - 393
Target Start/End: Original strand, 9007176 - 9007334
Alignment:
256 taataatgttatcaaggagcatttgattgatgttgattattcagtgcctgtgga------------ggaggaggaggagaagaacatgtttaattattca 343  Q
    |||||||||||  ||||||||||||||||||||||| |||||||| | ||||||            |||||| |||||| ||||||||||||||||||||    
9007176 taataatgttaaaaaggagcatttgattgatgttgactattcagttcttgtggatgatgatgatgaggaggaagaggaggagaacatgtttaattattca 9007275  T
344 attgctaatc---------ttcgagttcgtgttgatcatgacgatgatggtagcggggc 393  Q
     |||||||||         |||||||||||||||||||||| || ||||||||||||||    
9007276 gttgctaatcttcctgaaattcgagttcgtgttgatcatgatgacgatggtagcggggc 9007334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 307 - 393
Target Start/End: Original strand, 9029136 - 9029231
Alignment:
307 ggaggaggaggaggagaagaacatgtttaattattcaattgctaatcttc---------gagttcgtgttgatcatgacgatgatggtagcggggc 393  Q
    |||||| ||||||||| |||||||||||||||| ||| ||||||||||||         ||||||||||||||||||| || ||||||||||||||    
9029136 ggaggaagaggaggaggagaacatgtttaattaatcagttgctaatcttcctgaaattcgagttcgtgttgatcatgatgacgatggtagcggggc 9029231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 295539 times since January 2019
Visitors: 3016