View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_low_14 (Length: 459)

Name: NF1429_low_14
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1429_low_14
NF1429_low_14
[»] chr3 (1 HSPs)
chr3 (8-447)||(45380997-45381432)


Alignment Details
Target: chr3 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 8 - 447
Target Start/End: Original strand, 45380997 - 45381432
Alignment:
8 ggacatcatcattagcagtagacaccattatttttggcaagaatttctaaactaaaaacatatctagaatcacacacaatgaacacgtctcacattgttc 107  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45380997 ggacatcaacattagcagtagacaccattatttttggcaagaatttctaaactaaaaacatatctagaatcacacacaatgaacacgtctcacattgttc 45381096  T
108 tattttcgcgtgcaagttaaggatctatatctcgttacttttgctatgttatgaacacaaattctcctcnnnnnnncctatcttaattaatctactccta 207  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||       ||||||||||||||||||||||||    
45381097 tattttcgcgtgcaagttaaggatctatatctcgttacttttactatgttatgaacacaaattctcctctttttttcctatcttaattaatctactccta 45381196  T
208 cctaaataattcaacagttgttacaactgcaaattatacataacactttattcaaggnnnnnnntaatcaatccctcttccacaagaaacatgagctaga 307  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||  ||||||||    
45381197 cctaaataattcaatagttgttacaactgcaaattatacataacactttattcaaggaaaaaaataatcaatccctcttccacaagaaac--gagctaga 45381294  T
308 tttatatgtaacatattactttttccacttttcctagtttttgaattctaactaggctggcttataaagtttccttgcgatttgcattgttttataattt 407  Q
    ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
45381295 tttatatgtaac--attactttttccacttttcctagtttttgaattctaactaggctggcttataaagtttccttgtgatttgcattgttttataattt 45381392  T
408 caatggcaacaatcagcaacattggcttacaagggaattg 447  Q
    ||||||||||||||||||||||||||||||||||||||||    
45381393 caatggcaacaatcagcaacattggcttacaagggaattg 45381432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 125395 times since January 2019
Visitors: 1457