View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_low_14 (Length: 459)

Name: NF1429_low_14
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1429_low_14
[»] chr3 (1 HSPs)
chr3 (8-447)||(45380997-45381432)

Alignment Details
Target: chr3 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 8 - 447
Target Start/End: Original strand, 45380997 - 45381432
8 ggacatcatcattagcagtagacaccattatttttggcaagaatttctaaactaaaaacatatctagaatcacacacaatgaacacgtctcacattgttc 107  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45380997 ggacatcaacattagcagtagacaccattatttttggcaagaatttctaaactaaaaacatatctagaatcacacacaatgaacacgtctcacattgttc 45381096  T
108 tattttcgcgtgcaagttaaggatctatatctcgttacttttgctatgttatgaacacaaattctcctcnnnnnnncctatcttaattaatctactccta 207  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||       ||||||||||||||||||||||||    
45381097 tattttcgcgtgcaagttaaggatctatatctcgttacttttactatgttatgaacacaaattctcctctttttttcctatcttaattaatctactccta 45381196  T
208 cctaaataattcaacagttgttacaactgcaaattatacataacactttattcaaggnnnnnnntaatcaatccctcttccacaagaaacatgagctaga 307  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||  ||||||||    
45381197 cctaaataattcaatagttgttacaactgcaaattatacataacactttattcaaggaaaaaaataatcaatccctcttccacaagaaac--gagctaga 45381294  T
308 tttatatgtaacatattactttttccacttttcctagtttttgaattctaactaggctggcttataaagtttccttgcgatttgcattgttttataattt 407  Q
    ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
45381295 tttatatgtaac--attactttttccacttttcctagtttttgaattctaactaggctggcttataaagtttccttgtgatttgcattgttttataattt 45381392  T
408 caatggcaacaatcagcaacattggcttacaagggaattg 447  Q
45381393 caatggcaacaatcagcaacattggcttacaagggaattg 45381432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 318715 times since January 2019
Visitors: 3039