View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_low_15 (Length: 452)

Name: NF1429_low_15
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1429_low_15
NF1429_low_15
[»] chr1 (9 HSPs)
chr1 (11-435)||(8787652-8788076)
chr1 (122-263)||(8787595-8787736)
chr1 (301-435)||(8782184-8782318)
chr1 (136-243)||(8781938-8782045)
chr1 (295-364)||(8782055-8782124)
chr1 (273-435)||(8776166-8776328)
chr1 (11-75)||(8781981-8782045)
chr1 (199-247)||(8782124-8782172)
chr1 (32-76)||(8782125-8782169)


Alignment Details
Target: chr1 (Bit Score: 376; Significance: 0; HSPs: 9)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 376; E-Value: 0
Query Start/End: Original strand, 11 - 435
Target Start/End: Original strand, 8787652 - 8788076
Alignment:
11 cacagattggtcaacctgggcagtgagtcactaggacaaaattcaagtgataagcaaaattcactattttctgatcccgcatttgaaaaaagcaatgaac 110  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8787652 cacatattggtcaacctgggcagtgagtcactaggacaaaattcaagtgataagcaaaattcactattttctgatcccgcatttgaaaaaagcaatgaac 8787751  T
111 tattccttgatcctacatatgatcctcctggttatattagcgatgatgttggtgtagatgaaggtgatcacagatcggtcaatctgggtagtgagtcgct 210  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
8787752 tattccttgatcctacatatgatcctcctggttatattagtgatgatgttggtgtagatgaaggtgatcacagattggtcaatctgggtagtgagtcgct 8787851  T
211 aggacaaagttcacgttttaagcaaaattcactagtttctgatccggcatttgnnnnnnntaatgaactaatccttaattctgcgacgagtgttgatggt 310  Q
    |||||||| |||| |||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||| ||||||||||    
8787852 aggacaaatttcatgttttaagcaaaattcactagtttctgatccggcatttgaaaaaaataatgaactaatccttaattctgcgacgattgttgatggt 8787951  T
311 gataaggagtatatgagttgtaagaataccacaaacacacccacggtggaggatgggggtaattgctccgatccagatgttactattttggaaccttatg 410  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
8787952 gataaggagtatatgagttgtaagaataccacaaacacacccacggtggaggatgggggtaattgctccgatccagatgttactattttggaaccttatc 8788051  T
411 aagtttgtgaagatacccctttcgt 435  Q
    |||||||||||||||||||||||||    
8788052 aagtttgtgaagatacccctttcgt 8788076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 122 - 263
Target Start/End: Original strand, 8787595 - 8787736
Alignment:
122 cctacatatgatcctcctggttatattagcgatgatgttggtgtagatgaaggtgatcacagatcggtcaatctgggtagtgagtcgctaggacaaagtt 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || |||||| ||||| |||||||| |||||||||| ||    
8787595 cctacatatgatcctcctggttatattagcgatgatgttggtgtagatgaagatgatcacatattggtcaacctgggcagtgagtcactaggacaaaatt 8787694  T
222 cacgttttaagcaaaattcactagtttctgatccggcatttg 263  Q
    || ||  |||||||||||||||| |||||||||| |||||||    
8787695 caagtgataagcaaaattcactattttctgatcccgcatttg 8787736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 301 - 435
Target Start/End: Original strand, 8782184 - 8782318
Alignment:
301 tgttgatggtgataaggagtatatgagttgtaagaataccacaaacacacccacggtggaggatgggggtaattgctccgatccagatgttactattttg 400  Q
    |||||| ||||||||||||||||||  | |||||| ||||||||||||| ||| ||||||||||||||||| |  ||||||||||||||| |||||||||    
8782184 tgttgacggtgataaggagtatatgcatggtaagagtaccacaaacacatccaaggtggaggatgggggtattccctccgatccagatgtaactattttg 8782283  T
401 gaaccttatgaagtttgtgaagatacccctttcgt 435  Q
     || |||||  | ||||||||| || |||||||||    
8782284 aaatcttatccaatttgtgaagctaaccctttcgt 8782318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 136 - 243
Target Start/End: Original strand, 8781938 - 8782045
Alignment:
136 tcctggttatattagcgatgatgttggtgtagatgaaggtgatcacagatcggtcaatctgggtagtgagtcgctaggacaaagttcacgttttaagcaa 235  Q
    ||||||| |||| |||||||||||||||||| |||||| ||||||||||| ||| ||||| ||||||||||| |||||| |||||||| || |||||| |    
8781938 tcctggtcatatcagcgatgatgttggtgtaaatgaagatgatcacagattggttaatctaggtagtgagtcactaggaaaaagttcaagtgttaagcga 8782037  T
236 aattcact 243  Q
    ||||||||    
8782038 aattcact 8782045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 364
Target Start/End: Original strand, 8782055 - 8782124
Alignment:
295 gacgagtgttgatggtgataaggagtatatgagttgtaagaataccacaaacacacccacggtggaggat 364  Q
    ||||| ||||||||||||||||||||||||  || |||||||||||| ||||||| ||| ||||||||||    
8782055 gacgattgttgatggtgataaggagtatatccgtggtaagaataccaaaaacacatccaaggtggaggat 8782124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 273 - 435
Target Start/End: Original strand, 8776166 - 8776328
Alignment:
273 atgaactaatccttaattctgcgacgagtgttgatggtgataaggagtatatgagttgtaagaataccacaaacacacccacggtggaggatgggggtaa 372  Q
    |||||| | |||||||||||| ||||| ||||||||  |||||||||||| |  ||   ||||||||||| |||||| |||  |||||||||| |  |||    
8776166 atgaacaattccttaattctgtgacgattgttgatgacgataaggagtattttcgtgacaagaataccaccaacacatccaatgtggaggatgagaataa 8776265  T
373 ttgctccgatccagatgttactattttggaaccttatgaagtttgtgaagatacccctttcgt 435  Q
    || ||| ||| ||||| | | |||||||||  |||||  | |||||||| | |||||||||||    
8776266 ttcctctgattcagatctgattattttggattcttatccaatttgtgaaaacacccctttcgt 8776328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 11 - 75
Target Start/End: Original strand, 8781981 - 8782045
Alignment:
11 cacagattggtcaacctgggcagtgagtcactaggacaaaattcaagtgataagcaaaattcact 75  Q
    ||||||||||| || || || ||||||||||||||| ||| |||||||| ||||| |||||||||    
8781981 cacagattggttaatctaggtagtgagtcactaggaaaaagttcaagtgttaagcgaaattcact 8782045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 199 - 247
Target Start/End: Original strand, 8782124 - 8782172
Alignment:
199 tagtgagtcgctaggacaaagttcacgttttaagcaaaattcactagtt 247  Q
    ||||||||| ||||||||||||||| || |||||| |||||||||||||    
8782124 tagtgagtcactaggacaaagttcaagtgttaagcgaaattcactagtt 8782172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 32 - 76
Target Start/End: Original strand, 8782125 - 8782169
Alignment:
32 agtgagtcactaggacaaaattcaagtgataagcaaaattcacta 76  Q
    ||||||||||||||||||| |||||||| ||||| ||||||||||    
8782125 agtgagtcactaggacaaagttcaagtgttaagcgaaattcacta 8782169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 115735 times since January 2019
Visitors: 1394