View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_low_20 (Length: 402)

Name: NF1429_low_20
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1429_low_20
NF1429_low_20
[»] chr1 (5 HSPs)
chr1 (1-394)||(11025789-11026182)
chr1 (3-387)||(11040494-11040878)
chr1 (1-394)||(10930129-10930522)
chr1 (1-394)||(10992333-10992726)
chr1 (19-64)||(10991327-10991372)


Alignment Details
Target: chr1 (Bit Score: 390; Significance: 0; HSPs: 5)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 390; E-Value: 0
Query Start/End: Original strand, 1 - 394
Target Start/End: Original strand, 11025789 - 11026182
Alignment:
1 catttttcttaagttagctttcataaatgcaggatcaattttaggatcattgttttttatcttgttgattggtggaatctaccatatttatgactcttgc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
11025789 catttttcttaagttagctttcataaatgcaggatcaattttaggatcattgttttttatcttgttgattggtggaatctaccatatttatgactcttac 11025888  T
101 atactaaagaaagaaaaacaagcaattgtagaaaagtttttagaagactatagagttcttaagcccaccagatactcttatgtagaaatcaagagaatca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11025889 atactaaagaaagaaaaacaagcaattgtagaaaagtttttagaagactatagagttcttaagcccaccagatactcttatgtagaaatcaagagaatca 11025988  T
201 caaataatttcggggatatgttaggacaaggagcctatggaactgtttataaaggaagcatttcaaaagaatttagtgttgctgtgaagatactaaatgt 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11025989 caaataatttcggggatatgttaggacaaggagcctatggaactgtttataaaggaagcatttcaaaagaatttagtgttgctgtgaagatactaaatgt 11026088  T
301 ttctcagggaaatggccaagacttcctaaatgaagttggtacaatgagtagaatccaccatgttaatattgtccgattggtcggtttctgtgct 394  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11026089 ttctcagggaaatggccaagacttcctaaatgaagttggtacaatgagtagaatccaccatgttaatattgtccgattggtcggtttctgtgct 11026182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 3 - 387
Target Start/End: Original strand, 11040494 - 11040878
Alignment:
3 tttttcttaagttagctttcataaatgcaggatcaattttaggatcattgttttttatcttgttgattggtggaatctaccatatttatgactcttgcat 102  Q
    |||||||||| ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| ||| ||||||||||||||||| |||    
11040494 tttttcttaaattagctttcataaatgcaggatcaattttaggatcgttgtttttcatcttgttgattggtggagtcttccatatttatgactcttacat 11040593  T
103 actaaagaaagaaaaacaagcaattgtagaaaagtttttagaagactatagagttcttaagcccaccagatactcttatgtagaaatcaagagaatcaca 202  Q
    ||||| ||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||||||||||||    
11040594 actaaggaaagaaaaacaagcaattatagaaaagtttttagaagactatagagctcttaagccaaccagatactcttatgtagaaattaagagaatcaca 11040693  T
203 aataatttcggggatatgttaggacaaggagcctatggaactgtttataaaggaagcatttcaaaagaatttagtgttgctgtgaagatactaaatgttt 302  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11040694 aataatttcggggatatgttaggacaaggagcctatggaactgtttataaaggaagcatttcaaaagaatttagtgttgctgtgaagatactaaatgttt 11040793  T
303 ctcagggaaatggccaagacttcctaaatgaagttggtacaatgagtagaatccaccatgttaatattgtccgattggtcggttt 387  Q
    |||||||||||||||||||||||||||||||||| ||||||||| ||||||| ||||||||||||||||| || ||| |||||||    
11040794 ctcagggaaatggccaagacttcctaaatgaagtgggtacaatgggtagaatacaccatgttaatattgttcgtttgatcggttt 11040878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 394
Target Start/End: Original strand, 10930129 - 10930522
Alignment:
1 catttttcttaagttagctttcataaatgcaggatcaattttaggatcattgttttttatcttgttgattggtggaatctaccatatttatgactcttgc 100  Q
    |||||||||||| |||  ||||||||||||||||||||||||||| || || |||||| ||||||||| ||||| ||||||||||||||||||||||| |    
10930129 catttttcttaaattaattttcataaatgcaggatcaattttaggttcgttattttttgtcttgttgactggtgcaatctaccatatttatgactcttac 10930228  T
101 atactaaagaaagaaaaacaagcaattgtagaaaagtttttagaagactatagagttcttaagcccaccagatactcttatgtagaaatcaagagaatca 200  Q
    |||| |||||||||||||||||| ||| ||||||||||||||||||| ||||||| |||||||||||| |||||||| |||| |||||| || |||||||    
10930229 atacaaaagaaagaaaaacaagccattatagaaaagtttttagaagattatagagctcttaagcccacaagatactcatatgaagaaattaaaagaatca 10930328  T
201 caaataatttcggggatatgttaggacaaggagcctatggaactgtttataaaggaagcatttcaaaagaatttagtgttgctgtgaagatactaaatgt 300  Q
    |||||||||| || || | |||||||||||| |||||||||||||| |||| ||||||||||||||||||| | | ||||||||||||||||||||||||    
10930329 caaataattttggcgacaagttaggacaaggtgcctatggaactgtatatagaggaagcatttcaaaagaaatcattgttgctgtgaagatactaaatgt 10930428  T
301 ttctcagggaaatggccaagacttcctaaatgaagttggtacaatgagtagaatccaccatgttaatattgtccgattggtcggtttctgtgct 394  Q
    ||| || ||||| || ||||| ||||| |||||||||||||||||| |||||||||| ||||||||||||||  ||||||||||||||||||||    
10930429 ttcacaaggaaacgggcaagatttcctcaatgaagttggtacaatgggtagaatccatcatgttaatattgttagattggtcggtttctgtgct 10930522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 394
Target Start/End: Original strand, 10992333 - 10992726
Alignment:
1 catttttcttaagttagctttcataaatgcaggatcaattttaggatcattgttttttatcttgttgattggtggaatctaccatatttatgactcttgc 100  Q
    |||||||||||| |||| |||||||||| ||||||||||| |||||||  |||||||| ||||||| |  |||| | |||||||  |||||||||||| |    
10992333 catttttcttaaattagttttcataaatccaggatcaattctaggatcgctgttttttgtcttgttaaccggtgcagtctaccacgtttatgactcttac 10992432  T
101 atactaaagaaagaaaaacaagcaattgtagaaaagtttttagaagactatagagttcttaagcccaccagatactcttatgtagaaatcaagagaatca 200  Q
    ||||| || |||| ||||||||||||| ||||||||||||||||||| ||||||| |||||| ||||| |||||||||||||||||||| ||||||||||    
10992433 atactgaacaaagcaaaacaagcaattatagaaaagtttttagaagattatagagctcttaaacccacgagatactcttatgtagaaattaagagaatca 10992532  T
201 caaataatttcggggatatgttaggacaaggagcctatggaactgtttataaaggaagcatttcaaaagaatttagtgttgctgtgaagatactaaatgt 300  Q
    ||||||| ||  | || | |||||||||||| |||||||||||||| |||| ||||||||||||||||||| | | |||||||||||||||||||||| |    
10992533 caaataactttagtgacaagttaggacaaggtgcctatggaactgtatatagaggaagcatttcaaaagaaatcattgttgctgtgaagatactaaattt 10992632  T
301 ttctcagggaaatggccaagacttcctaaatgaagttggtacaatgagtagaatccaccatgttaatattgtccgattggtcggtttctgtgct 394  Q
    |||||| ||||| || ||||| ||||| |||||||||||||||||  |||||| ||| ||||||||||||||  ||||||||||||||||||||    
10992633 ttctcaaggaaacgggcaagatttcctcaatgaagttggtacaattggtagaacccatcatgttaatattgttagattggtcggtttctgtgct 10992726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 64
Target Start/End: Original strand, 10991327 - 10991372
Alignment:
19 tttcataaatgcaggatcaattttaggatcattgttttttatcttg 64  Q
    ||||||||||||||| ||||||||||||||| ||||||||||||||    
10991327 tttcataaatgcagggtcaattttaggatcaatgttttttatcttg 10991372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 37777 times since January 2019
Visitors: 1597