View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_low_21 (Length: 395)

Name: NF1429_low_21
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1429_low_21
NF1429_low_21
[»] chr7 (1 HSPs)
chr7 (13-377)||(44244707-44245076)


Alignment Details
Target: chr7 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 13 - 377
Target Start/End: Original strand, 44244707 - 44245076
Alignment:
13 atactttgaacttctacataggagcaatatcagttgttaaagcttcaaacattagttcaacttggattatgagacacttttcttcgattgatttcatgat 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
44244707 atactttgaacttctacataggagcaatatcagttgttaaagcttcaaacattagttcaacttggattatgaaacacttttcttcgattgatttcatgat 44244806  T
113 gtttatataacaagatgttcccagatcttgttataannnnnnnngttaaagtatggagtattcattactgttagacgacaactaatctccatcggcggac 212  Q
    ||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
44244807 gtttatataacaagatgttcccagatcttgttataattttttttgttaaagtatggagtattcattactgttagatgacaactaatctccatcggcggac 44244906  T
213 ttattaggcatatagaatagatttcctcatccaactaaattttctcattttgcaatgt---ttgaatagtagggatgttgtacatttctcaatttaaata 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||    
44244907 ttattaggcatatagaatagatttcctcatccaactaaattttctcattttgcaatgtacattgaatagtagggatgttgtacatttctcaatttaaata 44245006  T
310 cagannnnnnnnattatagttctaaatatatctaag--tgtcttcattacgctcaaaacgataacaatgg 377  Q
    ||||        ||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||    
44245007 cagattttttttattatagttctaaatatatctaagtatgtcttcattacgctcaaaacgataacaatgg 44245076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 29969 times since January 2019
Visitors: 1588