View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_low_23 (Length: 376)

Name: NF1429_low_23
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1429_low_23
NF1429_low_23
[»] chr4 (1 HSPs)
chr4 (14-362)||(15026230-15026578)
[»] chr1 (1 HSPs)
chr1 (83-362)||(21365698-21365977)
[»] chr3 (1 HSPs)
chr3 (139-362)||(26695899-26696122)


Alignment Details
Target: chr4 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 14 - 362
Target Start/End: Original strand, 15026230 - 15026578
Alignment:
14 atatgtaaatgtactaaatcttgaaataataataatgtttgtgtgtatatattctgattaaataactaaaatgcaggcacaatacttgaaaaacgatcca 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
15026230 atatgtaaatgtactaaatcttgaaataataataatgtttgtgtgtatatattctgattaaataactaaaatgtaggcacaatacttgaaaaacgatcca 15026329  T
114 gattacatgagctgcaaaaagaaagaatgcaagaaagaacagaatgggaaatgcagtgtgacaacttgtagtggttcaataaagtttcatgttatcaaca 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15026330 gattacatgagctgcaaaaagaaagaatgcaagaaagaacagaatgggaaatgcagtgtgacaacttgtagtggttcaataaagtttcatgttatcaaca 15026429  T
214 ttagaagtgatatagagtttgtgttcttcactggtggctttctcaccccctgccttgttggaagatccactcctttgagttttgctaatcctaagaagcc 313  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| ||||| |||||||||||||||||||||||||||||||||||    
15026430 ttagaagtgatatagaatttgtgttcttcactggtggctttctcaccccgtgccttgtcggaaggtccactcctttgagttttgctaatcctaagaagcc 15026529  T
314 actttatggacatatctcaagtatagattcaactgcaacatcggtaagt 362  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
15026530 actttatggacatatctcaagtatagattcaactgcaacatcggtaagt 15026578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 83 - 362
Target Start/End: Original strand, 21365698 - 21365977
Alignment:
83 aatgcaggcacaatacttgaaaaacgatccagattacatgagctgcaaaaagaaagaatgcaagaaagaacagaatgggaaatgcagtgtgacaacttgt 182  Q
    |||| ||||||| |||||||||||||||||||||||| | || |||||||||||||||||||||||||| |  ||||| ||||||| ||||||||||||     
21365698 aatgtaggcacagtacttgaaaaacgatccagattacctaagttgcaaaaagaaagaatgcaagaaagagcttaatggaaaatgcattgtgacaacttgc 21365797  T
183 agtggttcaataaagtttcatgttatcaacattagaagtgatatagagtttgtgttcttcactggtggctttctcaccccctgccttgttggaagatcca 282  Q
    |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |||||||||||||||||||| |||||| ||||||| ||||    
21365798 agtggttcaataaagtttcatgttatcaacataagaagtgacatagagtttgtgttctttactggtggctttctcaccccttgccttattggaaggtcca 21365897  T
283 ctcctttgagttttgctaatcctaagaagccactttatggacatatctcaagtatagattcaactgcaacatcggtaagt 362  Q
    |||||||| |||||||||||||||| |||||||||||||||||| ||||||| |||||||||||||| ||||| ||||||    
21365898 ctcctttgggttttgctaatcctaacaagccactttatggacatctctcaagcatagattcaactgctacatcagtaagt 21365977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 140; Significance: 3e-73; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 139 - 362
Target Start/End: Original strand, 26695899 - 26696122
Alignment:
139 aatgcaagaaagaacagaatgggaaatgcagtgtgacaacttgtagtggttcaataaagtttcatgttatcaacattagaagtgatatagagtttgtgtt 238  Q
    ||||||||||||| |  ||||||||||||| ||||||||||||||||||||||||||||||||||||||  ||||| |||||||| ||||| ||||||||    
26695899 aatgcaagaaagagcttaatgggaaatgcattgtgacaacttgtagtggttcaataaagtttcatgttacaaacataagaagtgacatagaatttgtgtt 26695998  T
239 cttcactggtggctttctcaccccctgccttgttggaagatccactcctttgagttttgctaatcctaagaagccactttatggacatatctcaagtata 338  Q
    ||| |||||||| ||||||| |||||||||| ||||||| |||||||||||| | ||| |||||||||| |||||||||||||||||| ||||||| |||    
26695999 ctttactggtgggtttctcagcccctgcctttttggaaggtccactcctttgggattttctaatcctaacaagccactttatggacatctctcaagcata 26696098  T
339 gattcaactgcaacatcggtaagt 362  Q
    ||||||||||||||||| ||||||    
26696099 gattcaactgcaacatcagtaagt 26696122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 125461 times since January 2019
Visitors: 1458