View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_low_24 (Length: 363)

Name: NF1429_low_24
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1429_low_24
[»] chr1 (3 HSPs)
chr1 (8-345)||(11025357-11025699)
chr1 (8-63)||(11040348-11040403)
chr1 (149-190)||(12062574-12062615)
[»] chr6 (1 HSPs)
chr6 (149-190)||(8186442-8186483)

Alignment Details
Target: chr1 (Bit Score: 286; Significance: 1e-160; HSPs: 3)
Name: chr1

Target: chr1; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 8 - 345
Target Start/End: Complemental strand, 11025699 - 11025357
8 aaattatactagctagccttagcttatgtcattgattgattgtaaaggatattaatatcccaagtatttgtcttaattgatgcttgaaatacaccctatt 107  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11025699 aaatcatactagctagccttagcttatgtcattgattgattgtaaaggatattaatatcccaagtatttgtcttaattgatgcttgaaatacaccctatt 11025600  T
108 ctgtcctttttgttcatccataatcaaannnnnnngaatttgatacatcatcttttgttgatccaaagatcttttataaatagaatcagagagagtactt 207  Q
    ||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
11025599 ctgtcctttttgttcatccataatcaaatttttttgaatttgatacatcatcttttgttgatccaaaggtcttttataaatagaatcagagagagtactt 11025500  T
208 tctaattac-----aatgatcgtctttatgcttgttttgattggttgtaagagcataatcatgatgagtcactataatttttgcaaaaactacattttag 302  Q
    |||||||||     |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||    
11025499 tctaattacaatataatgatcgtctttatgcttgttttgattggttgtgagagcataatcatgatgagtcactataattttggcaaaaactacattttag 11025400  T
303 agctttacaaaaccaaggtacccgtgattttggcaatctaaac 345  Q
11025399 agctttacaaaaccaaggtacccgtgattttggcaatctaaac 11025357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 8 - 63
Target Start/End: Complemental strand, 11040403 - 11040348
8 aaattatactagctagccttagcttatgtcattgattgattgtaaaggatattaat 63  Q
    |||| |||||||||| | ||||||||||| |||||||||||||||| |||| ||||    
11040403 aaatcatactagctaacattagcttatgttattgattgattgtaaaagatactaat 11040348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 149 - 190
Target Start/End: Complemental strand, 12062615 - 12062574
149 gatacatcatcttttgttgatccaaagatcttttataaatag 190  Q
    ||||||||| |||||||||||| ||| |||||||||||||||    
12062615 gatacatcaacttttgttgatcaaaatatcttttataaatag 12062574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 149 - 190
Target Start/End: Original strand, 8186442 - 8186483
149 gatacatcatcttttgttgatccaaagatcttttataaatag 190  Q
    ||||||||| ||||||||||||||||  ||||||||||||||    
8186442 gatacatcaacttttgttgatccaaatttcttttataaatag 8186483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 175476 times since January 2019
Visitors: 2677