View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_low_24 (Length: 363)

Name: NF1429_low_24
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1429_low_24
NF1429_low_24
[»] chr1 (3 HSPs)
chr1 (8-345)||(11025357-11025699)
chr1 (8-63)||(11040348-11040403)
chr1 (149-190)||(12062574-12062615)
[»] chr6 (1 HSPs)
chr6 (149-190)||(8186442-8186483)


Alignment Details
Target: chr1 (Bit Score: 286; Significance: 1e-160; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 8 - 345
Target Start/End: Complemental strand, 11025699 - 11025357
Alignment:
8 aaattatactagctagccttagcttatgtcattgattgattgtaaaggatattaatatcccaagtatttgtcttaattgatgcttgaaatacaccctatt 107  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11025699 aaatcatactagctagccttagcttatgtcattgattgattgtaaaggatattaatatcccaagtatttgtcttaattgatgcttgaaatacaccctatt 11025600  T
108 ctgtcctttttgttcatccataatcaaannnnnnngaatttgatacatcatcttttgttgatccaaagatcttttataaatagaatcagagagagtactt 207  Q
    ||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
11025599 ctgtcctttttgttcatccataatcaaatttttttgaatttgatacatcatcttttgttgatccaaaggtcttttataaatagaatcagagagagtactt 11025500  T
208 tctaattac-----aatgatcgtctttatgcttgttttgattggttgtaagagcataatcatgatgagtcactataatttttgcaaaaactacattttag 302  Q
    |||||||||     |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||    
11025499 tctaattacaatataatgatcgtctttatgcttgttttgattggttgtgagagcataatcatgatgagtcactataattttggcaaaaactacattttag 11025400  T
303 agctttacaaaaccaaggtacccgtgattttggcaatctaaac 345  Q
    |||||||||||||||||||||||||||||||||||||||||||    
11025399 agctttacaaaaccaaggtacccgtgattttggcaatctaaac 11025357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 8 - 63
Target Start/End: Complemental strand, 11040403 - 11040348
Alignment:
8 aaattatactagctagccttagcttatgtcattgattgattgtaaaggatattaat 63  Q
    |||| |||||||||| | ||||||||||| |||||||||||||||| |||| ||||    
11040403 aaatcatactagctaacattagcttatgttattgattgattgtaaaagatactaat 11040348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 149 - 190
Target Start/End: Complemental strand, 12062615 - 12062574
Alignment:
149 gatacatcatcttttgttgatccaaagatcttttataaatag 190  Q
    ||||||||| |||||||||||| ||| |||||||||||||||    
12062615 gatacatcaacttttgttgatcaaaatatcttttataaatag 12062574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 149 - 190
Target Start/End: Original strand, 8186442 - 8186483
Alignment:
149 gatacatcatcttttgttgatccaaagatcttttataaatag 190  Q
    ||||||||| ||||||||||||||||  ||||||||||||||    
8186442 gatacatcaacttttgttgatccaaatttcttttataaatag 8186483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 30857 times since January 2019
Visitors: 1588