View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_low_26 (Length: 356)

Name: NF1429_low_26
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1429_low_26
NF1429_low_26
[»] chr5 (4 HSPs)
chr5 (17-339)||(38222069-38222385)
chr5 (10-339)||(38228427-38228750)
chr5 (17-325)||(38158731-38159030)
chr5 (17-320)||(38152397-38152697)


Alignment Details
Target: chr5 (Bit Score: 280; Significance: 1e-157; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 17 - 339
Target Start/End: Original strand, 38222069 - 38222385
Alignment:
17 ttataccaagaagttggtgcacatgaagattaagatgagcacaacaagtgagtggtagatttgaatgtttgaagtcgctgaacttttgtggggagtaggc 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38222069 ttataccaagaagttggtgcacatgaagattaagatgagcacaacaagtgagtggtagatttgaatgtttgaagtcgctgaacttttgtggggagtaggc 38222168  T
117 tgaggagctggtgcaagtgcaacatgttcattaacatcaattgcaaccttcactccacgctgacagaaacctcctccgcttatgaagtaatgggtctttg 216  Q
    ||||||||||||||      |||||||||||||||||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |    
38222169 tgaggagctggtgc------aacatgttcattaacatcgattgcgaccttcactccgcgctgacagaaacctcctccgcttatgaagtaatgggtcttgg 38222262  T
217 cctcactcaactgaaaaacttctcttccaacacctgttgttatgttcttgatgaatccactatctatgcagttttcatagcttgtcttgttcacctccaa 316  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38222263 cctcactcaactgaaaaacttctcttccgacacctgttgttatgttcttgatgaatccactatctatgcagttttcatagcttgtcttgttcacctccaa 38222362  T
317 cacactgaagaaatgcctatcat 339  Q
    |||||||||||||||||||||||    
38222363 cacactgaagaaatgcctatcat 38222385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 10 - 339
Target Start/End: Original strand, 38228427 - 38228750
Alignment:
10 attattcttataccaagaagttggtgcacatgaagattaagatgagcacaacaagtgagtggtagatttgaatgtttgaagtcgctgaacttttgtgggg 109  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
38228427 attattattataccaagaagttggtgcacatgaagattaagatgagcacagcaagtgagtggtagatttgaatgtttgaagtcgctgaacttttgtgggg 38228526  T
110 agtaggctgaggagctggtgcaagtgcaacatgttcattaacatcaattgcaaccttcactccacgctgacagaaacctcctccgcttatgaagtaatgg 209  Q
    |||||||||||||||||||||      |||||||||||||||||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||    
38228527 agtaggctgaggagctggtgc------aacatgttcattaacatcgattgcgaccttcactccgcgctgacagaaacctcctccgcttatgaagtaatgg 38228620  T
210 gtctttgcctcactcaactgaaaaacttctcttccaacacctgttgttatgttcttgatgaatccactatctatgcagttttcatagcttgtcttgttca 309  Q
    ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38228621 gtcttggcctcactcaactgaaaaacttctcttccgacacctgttgttatgttcttgatgaatccactatctatgcagttttcatagcttgtcttgttca 38228720  T
310 cctccaacacactgaagaaatgcctatcat 339  Q
    ||||||||||||||||||||||||||||||    
38228721 cctccaacacactgaagaaatgcctatcat 38228750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 17 - 325
Target Start/End: Original strand, 38158731 - 38159030
Alignment:
17 ttataccaagaagttggtgcacatgaagattaagatgagcacaacaagtgagtggtagatttgaatgtttgaagtcgctgaacttttgtggggagtaggc 116  Q
    ||||||||||| |||||||||||| ||||||||||||||||||     ||| ||||| |||| |||||||||||    ||||| ||||||||||||||||    
38158731 ttataccaagaggttggtgcacatcaagattaagatgagcacaga---tgaatggtaaatttaaatgtttgaagcatttgaacctttgtggggagtaggc 38158827  T
117 tgaggagctggtgcaagtgcaacatgttcattaacatcaattgcaaccttcactccacgctgacagaaacctcctccgcttatgaagtaatgggtctttg 216  Q
    ||||||||||||||      |||||||||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||| |||||| |    
38158828 tgaggagctggtgc------aacatgttcattaacatcgattgcgaccttcactccgcgctgacagaaacctcctccgcttatgaagtaataggtcttgg 38158921  T
217 cctcactcaactgaaaaacttctcttccaacacctgttgttatgttcttgatgaatccactatctatgcagttttcatagcttgtcttgttcacctccaa 316  Q
    ||||| | | | ||||||| ||||||||| | ||  ||||||||||||||||||| ||  ||||||||||||||||||||||||||||||||||||||||    
38158922 cctcagttagcagaaaaacatctcttccaccgccccttgttatgttcttgatgaaccctgtatctatgcagttttcatagcttgtcttgttcacctccaa 38159021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 17 - 320
Target Start/End: Original strand, 38152397 - 38152697
Alignment:
17 ttataccaagaagttggtgcacatgaagattaagatgagcacaacaagtgagtggtagatttgaatgtttgaagtcgctga---acttttgtggggagta 113  Q
    |||||||||||   ||||||| || ||| |||||||||| || ||||||||||||||||||||||||||| |||   |||    || |||||||||||||    
38152397 ttataccaagagaatggtgcaaatcaaggttaagatgagtaccacaagtgagtggtagatttgaatgtttaaagcatctgtgccacctttgtggggagta 38152496  T
114 ggctgaggagctggtgcaagtgcaacatgttcattaacatcaattgcaaccttcactccacgctgacagaaacctcctccgcttatgaagtaatgggtct 213  Q
    || ||||||||||||||||      ||| |||||||||||||||||||||||||| ||||| |  ||||  ||||||||| ||||||||||||| | |||    
38152497 ggttgaggagctggtgcaa------catattcattaacatcaattgcaaccttcaatccactccaacagccacctcctccacttatgaagtaatagatct 38152590  T
214 ttgcctcactcaactgaaaaacttctcttccaacacctgttgttatgttcttgatgaatccactatctatgcagttttcatagcttgtcttgttcacctc 313  Q
    |  | ||| ||| ||||||||| |||  ||   ||||  ||| ||||||||| ||||||||  |||| ||||||||||||||||||||||||||||||||    
38152591 tgtcttcagtcagctgaaaaacgtcttgtctgccaccccttgatatgttcttaatgaatcctgtatcgatgcagttttcatagcttgtcttgttcacctc 38152690  T
314 caacaca 320  Q
    || ||||    
38152691 cagcaca 38152697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 125113 times since January 2019
Visitors: 1446