View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_low_26 (Length: 356)

Name: NF1429_low_26
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1429_low_26
[»] chr5 (4 HSPs)
chr5 (17-339)||(38222069-38222385)
chr5 (10-339)||(38228427-38228750)
chr5 (17-325)||(38158731-38159030)
chr5 (17-320)||(38152397-38152697)

Alignment Details
Target: chr5 (Bit Score: 280; Significance: 1e-157; HSPs: 4)
Name: chr5

Target: chr5; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 17 - 339
Target Start/End: Original strand, 38222069 - 38222385
17 ttataccaagaagttggtgcacatgaagattaagatgagcacaacaagtgagtggtagatttgaatgtttgaagtcgctgaacttttgtggggagtaggc 116  Q
38222069 ttataccaagaagttggtgcacatgaagattaagatgagcacaacaagtgagtggtagatttgaatgtttgaagtcgctgaacttttgtggggagtaggc 38222168  T
117 tgaggagctggtgcaagtgcaacatgttcattaacatcaattgcaaccttcactccacgctgacagaaacctcctccgcttatgaagtaatgggtctttg 216  Q
    ||||||||||||||      |||||||||||||||||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |    
38222169 tgaggagctggtgc------aacatgttcattaacatcgattgcgaccttcactccgcgctgacagaaacctcctccgcttatgaagtaatgggtcttgg 38222262  T
217 cctcactcaactgaaaaacttctcttccaacacctgttgttatgttcttgatgaatccactatctatgcagttttcatagcttgtcttgttcacctccaa 316  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38222263 cctcactcaactgaaaaacttctcttccgacacctgttgttatgttcttgatgaatccactatctatgcagttttcatagcttgtcttgttcacctccaa 38222362  T
317 cacactgaagaaatgcctatcat 339  Q
38222363 cacactgaagaaatgcctatcat 38222385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 10 - 339
Target Start/End: Original strand, 38228427 - 38228750
10 attattcttataccaagaagttggtgcacatgaagattaagatgagcacaacaagtgagtggtagatttgaatgtttgaagtcgctgaacttttgtgggg 109  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
38228427 attattattataccaagaagttggtgcacatgaagattaagatgagcacagcaagtgagtggtagatttgaatgtttgaagtcgctgaacttttgtgggg 38228526  T
110 agtaggctgaggagctggtgcaagtgcaacatgttcattaacatcaattgcaaccttcactccacgctgacagaaacctcctccgcttatgaagtaatgg 209  Q
    |||||||||||||||||||||      |||||||||||||||||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||    
38228527 agtaggctgaggagctggtgc------aacatgttcattaacatcgattgcgaccttcactccgcgctgacagaaacctcctccgcttatgaagtaatgg 38228620  T
210 gtctttgcctcactcaactgaaaaacttctcttccaacacctgttgttatgttcttgatgaatccactatctatgcagttttcatagcttgtcttgttca 309  Q
    ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38228621 gtcttggcctcactcaactgaaaaacttctcttccgacacctgttgttatgttcttgatgaatccactatctatgcagttttcatagcttgtcttgttca 38228720  T
310 cctccaacacactgaagaaatgcctatcat 339  Q
38228721 cctccaacacactgaagaaatgcctatcat 38228750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 17 - 325
Target Start/End: Original strand, 38158731 - 38159030
17 ttataccaagaagttggtgcacatgaagattaagatgagcacaacaagtgagtggtagatttgaatgtttgaagtcgctgaacttttgtggggagtaggc 116  Q
    ||||||||||| |||||||||||| ||||||||||||||||||     ||| ||||| |||| |||||||||||    ||||| ||||||||||||||||    
38158731 ttataccaagaggttggtgcacatcaagattaagatgagcacaga---tgaatggtaaatttaaatgtttgaagcatttgaacctttgtggggagtaggc 38158827  T
117 tgaggagctggtgcaagtgcaacatgttcattaacatcaattgcaaccttcactccacgctgacagaaacctcctccgcttatgaagtaatgggtctttg 216  Q
    ||||||||||||||      |||||||||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||| |||||| |    
38158828 tgaggagctggtgc------aacatgttcattaacatcgattgcgaccttcactccgcgctgacagaaacctcctccgcttatgaagtaataggtcttgg 38158921  T
217 cctcactcaactgaaaaacttctcttccaacacctgttgttatgttcttgatgaatccactatctatgcagttttcatagcttgtcttgttcacctccaa 316  Q
    ||||| | | | ||||||| ||||||||| | ||  ||||||||||||||||||| ||  ||||||||||||||||||||||||||||||||||||||||    
38158922 cctcagttagcagaaaaacatctcttccaccgccccttgttatgttcttgatgaaccctgtatctatgcagttttcatagcttgtcttgttcacctccaa 38159021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 17 - 320
Target Start/End: Original strand, 38152397 - 38152697
17 ttataccaagaagttggtgcacatgaagattaagatgagcacaacaagtgagtggtagatttgaatgtttgaagtcgctga---acttttgtggggagta 113  Q
    |||||||||||   ||||||| || ||| |||||||||| || ||||||||||||||||||||||||||| |||   |||    || |||||||||||||    
38152397 ttataccaagagaatggtgcaaatcaaggttaagatgagtaccacaagtgagtggtagatttgaatgtttaaagcatctgtgccacctttgtggggagta 38152496  T
114 ggctgaggagctggtgcaagtgcaacatgttcattaacatcaattgcaaccttcactccacgctgacagaaacctcctccgcttatgaagtaatgggtct 213  Q
    || ||||||||||||||||      ||| |||||||||||||||||||||||||| ||||| |  ||||  ||||||||| ||||||||||||| | |||    
38152497 ggttgaggagctggtgcaa------catattcattaacatcaattgcaaccttcaatccactccaacagccacctcctccacttatgaagtaatagatct 38152590  T
214 ttgcctcactcaactgaaaaacttctcttccaacacctgttgttatgttcttgatgaatccactatctatgcagttttcatagcttgtcttgttcacctc 313  Q
    |  | ||| ||| ||||||||| |||  ||   ||||  ||| ||||||||| ||||||||  |||| ||||||||||||||||||||||||||||||||    
38152591 tgtcttcagtcagctgaaaaacgtcttgtctgccaccccttgatatgttcttaatgaatcctgtatcgatgcagttttcatagcttgtcttgttcacctc 38152690  T
314 caacaca 320  Q
    || ||||    
38152691 cagcaca 38152697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 431 times since January 2019
Visitors: 134