View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1429_low_33 (Length: 314)

Name: NF1429_low_33
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1429_low_33
NF1429_low_33
[»] chr3 (1 HSPs)
chr3 (1-300)||(34685348-34685657)


Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 300
Target Start/End: Complemental strand, 34685657 - 34685348
Alignment:
1 ctgctggtaataatatagttgtgtgtgtgttgagaagtgaacggctgcaacacaattttggtcat--------agatgtataagatgtatggaatcacat 92  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||        |||||||||||||||||||||||||||    
34685657 ctgctggtaataatatagttgtgtgtgtgttgagaagtgaacggttgcaacacaattttggtcattcatgtgtagatgtataagatgtatggaatcacat 34685558  T
93 tttagaattcaaattattgctgaattttagttaaatttgaattgattgagagtgtcccaatttaaatatgaccggaaccatcataagttgaataagttta 192  Q
     ||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34685557 gttagaattcaagttattgctgaattttagttaaagttgaattgattgagagtgtcccaatttaaatatgaccggaaccatcataagttgaataagttta 34685458  T
193 gttgaactatggcaactccattggggaatagtggactgaaataaatgaataaaaaacatgagtannnnnnnncct--aagagaaaaatatgagtataatt 290  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         ||   ||||||||||||||||||||||    
34685457 gttgaactatggcaactccattggggaatagtggactgaaataaatgaataaaaaacatgagtatttttttttctgagagagaaaaatatgagtataatt 34685358  T
291 aaagaggagt 300  Q
    ||||||||||    
34685357 aaagaggagt 34685348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 199161 times since January 2019
Visitors: 2774